Skip to Content
Merck
All Photos(1)

Key Documents

EHU030961

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAACTGTGCACAAAGGAGTGTGGATCCCTGAGGGTGAATCAATCAAGATTCCAGTCTGCATTAAAGTCATTGAGGACAAGAGTGGACGGCAGAGTTTTCAAGCTGTGACAGATCATATGCTGGCCATTGGCAGCCTGGACCATGCCCACATTGTAAGGCTGCTGGGACTATGCCCAGGGTCATCTCTGCAGCTTGTCACTCAATATTTGCCTCTGGGTTCTCTGCTGGATCATGTGAGACAACACCGGGGGGCACTGGGGCCACAGCTGCTGCTCAACTGGGGAGTACAAATTGCCAAGGGAATGTACTACCTTGAGGAACATGGTATGGTGCATAGAAACCTGGCTGCCCGAAACGTGCTACTCAAGTCACCCAGTCAGGTTCAGGTGGCAGATTTTGGTGTGGCTGACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Aili Wang et al.
Aging, 12(6), 4866-4878 (2020-03-15)
Development of specific serum biomarkers is essential to improve diagnosis and prognosis of non-small cell lung cancer (NSCLC). Here, we show that serum and tissue levels of miR-519d are significantly decreased in NSCLC patients. The low expression of miR-519d is
Human Papillomavirus Regulates HER3 Expression in Head and Neck Cancer: Implications for Targeted HER3 Therapy in HPV
Toni M Brand et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(12), 3072-3083 (2016-12-18)
Majid Momeny et al.
Cellular oncology (Dordrecht), 42(4), 491-504 (2019-04-27)
Pancreatic ductal adenocarcinoma (PDAC), the most common malignancy of the pancreas, is the fourth most common cause of cancer-related death in the USA. Local progression, early tumor dissemination and low efficacy of current treatments are the major reasons for its
Toni M Brand et al.
Cancer research, 78(9), 2383-2395 (2018-02-15)
Human papillomavirus (HPV) type 16 is implicated in approximately 75% of head and neck squamous cell carcinomas (HNSCC) that arise in the oropharynx, where viral expression of the E6 and E7 oncoproteins promote cellular transformation, tumor growth, and maintenance. An
Spencer S Watson et al.
Cell systems, 6(3), 329-342 (2018-03-20)
Extrinsic signals are implicated in breast cancer resistance to HER2-targeted tyrosine kinase inhibitors (TKIs). To examine how microenvironmental signals influence resistance, we monitored TKI-treated breast cancer cell lines grown on microenvironment microarrays composed of printed extracellular matrix proteins supplemented with

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service