Skip to Content
Merck
All Photos(1)

Documents

EHU002381

Sigma-Aldrich

MISSION® esiRNA

targeting human EGLN2, RAB4B-EGLN2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGGCAGCTATGTCATCAACGGGCGCACCAAGGCCATGGTGGCGTGTTACCCAGGCAACGGGCTCGGGTACGTAAGGCACGTTGACAATCCCCACGGCGATGGGCGCTGCATCACCTGTATCTATTACCTGAATCAGAACTGGGACGTTAAGGTGCATGGCGGCCTGCTGCAGATCTTCCCTGAGGGCCGGCCCGTGGTAGCCAACATCGAGCCACTCTTTGACCGGTTGCTCATTTTCTGGTCTGACCGGCGGAACCCCCACGAGGTGAAGCCAGCCTATGCCACCAGGTACGCCATCACTGTCTGGTATTTTGATGCCAAGGAGCGGGCAGCAGCCAAAGACAAGTATCAGCTAGCATCAGGACAGAAAGGTGTCCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAGTGGCCAGTCCCAGAGCCGCATGGCAGACAGCTTAAATGACTTCAGGAGAGCCCTGGGCCTGTGCTGGCTGCTCCTTCCCTGCCACCGCTGCTGCTTCTGACTTTGCCTCTGTCCTGCCTGGTGTGGAGGGCTCTGTCTGTTGCTGAGGACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Alessandro Rolfo et al.
PloS one, 5(10), e13288-e13288 (2010-10-23)
The pathogenesis of preeclampsia, a serious pregnancy disorder, is still elusive and its treatment empirical. Hypoxia Inducible Factor-1 (HIF-1) is crucial for placental development and early detection of aberrant regulatory mechanisms of HIF-1 could impact on the diagnosis and management
Ling Li et al.
The Journal of clinical investigation, 129(6), 2374-2389 (2019-03-27)
Acute kidney injury (AKI) can lead to chronic kidney disease (CKD) if injury is severe and/or repair is incomplete. However, the pathogenesis of CKD following renal ischemic injury is not fully understood. Capillary rarefaction and tubular hypoxia are common findings
R V Durán et al.
Oncogene, 32(38), 4549-4556 (2012-10-23)
Hypoxia-inducible factor (HIF) prolyl hydroxylases (PHDs) are α-ketoglutarate (αKG)-dependent dioxygenases that function as cellular oxygen sensors. However, PHD activity also depends on factors other than oxygen, especially αKG, a key metabolic compound closely linked to amino-acid metabolism. We examined the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service