Skip to Content
Merck
All Photos(1)

Key Documents

EMU075311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Egfr

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTGTGGGCCTGACTACTACGAAGTGGAAGAAGATGGCATCCGCAAGTGTAAAAAATGTGATGGGCCCTGTCGCAAAGTTTGTAATGGCATAGGCATTGGTGAATTTAAAGACACACTCTCCATAAATGCTACAAACATCAAACACTTCAAATACTGCACTGCCATCAGCGGGGACCTTCACATCCTGCCAGTGGCCTTTAAGGGGGATTCTTTCACGCGCACTCCTCCTCTAGACCCACGAGAACTAGAAATTCTAAAAACCGTAAAGGAAATAACAGGCTTTTTGCTGATTCAGGCTTGGCCTGATAACTGGACTGACCTCCATGCTTTCGAGAACCTAGAAATAATACGTGGCAGAACAAAGCAACATGGTCAGTTTTCTTTGGCGGTCGTTGGCCTGAACATCACATCACTGGGGCTGCGTTCCCTCAAGGAGATCAG

Ensembl | mouse accession no.

ENSMUSG00000020122

NCBI accession no.

NM_007912

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... EGFR(13649) , Egfr(13649)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Began Gopalan et al.
Biomaterials, 35(26), 7479-7487 (2014-06-11)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed lethal cancers in the world. We previously showed two imidazolium salts (IBN-1 and IBN-9) with a moderate efficacy for HCC. Here we report a more potent imidazolium compound IBN-65 (1-benzyl-2-phenyl-3-(4-isopropyl)-benzyl-imidazolium
Chuen-Mao Yang et al.
Journal of cellular physiology, 230(10), 2351-2361 (2015-04-30)
Carbon monoxide (CO), a reaction product of the cytoprotective heme oxygenase (HO)-1, displays an anti-inflammatory effect in various cellular injuries, but the precise mechanisms of HO-1 expression remain unknown. We used the transition metal carbonyl compound carbon monoxide-releasing molecule-2 (CORM-2)
Yong Bian et al.
Biochemical and biophysical research communications, 463(4), 612-617 (2015-06-06)
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates
Philippe Dje N'Guessan et al.
Biochemical and biophysical research communications, 450(2), 1038-1044 (2014-07-01)
Chronic lower airway inflammation is considered to be a major cause of pathogenesis and disease progression in chronic obstructive pulmonary disease (COPD). Moraxella catarrhalis is a COPD-associated pathogen causing exacerbations and bacterial colonization in the lower airways of patients, which
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service