Skip to Content
Merck
All Photos(1)

Key Documents

EHU122051

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chengyang Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 743-756 (2017-09-28)
To evaluate the effect of Liuweibuqi capsules on chronic obstructive pulmonary disease (COPD) through the JAK/STAT pathway. Lung function was measured with a spirometer. Changes in lung histology were observed using H&E staining. Cigarette smoke extract combined with lipopolysaccharide (CSE+LPS)
Young Yun Jung et al.
Frontiers in pharmacology, 9, 531-531 (2018-06-15)
Because of the essential role of signal transducer and activator of transcription 3 (STAT3) in proliferation, anti-apoptosis, and chemoresistance of multiple myeloma (MM), we investigated whether icariin, a prenylated flavonol glycoside, inhibits both constitutive and inducible STAT3 activation in human
M Bam et al.
Translational psychiatry, 7(8), e1222-e1222 (2017-08-30)
Chronic inflammation is a characteristic of post-traumatic stress disorder (PTSD). The initiation of inflammation and molecules involved are not yet clearly understood. Here, we provide compelling evidence that the inflammation seen in PTSD may result from the dysregulated miRNA processing
Jong Hyun Lee et al.
Journal of advanced research, 26, 83-94 (2020-11-03)
Epithelial-mesenchymal transition (EMT) is a process of transdifferentiation where epithelial cells attain mesenchymal phenotype to gain invasive properties and thus, can contribute to metastasis of tumor cells. The antimetastatic and antitumor efficacy of brusatol (BT) was investigated in a hepatocellular
Thijs S Stutvoet et al.
The Journal of pathology, 249(1), 52-64 (2019-04-12)
Immune checkpoint inhibitors targeting programmed cell death protein 1 (PD-1) and programmed death-ligand 1 (PD-L1) have improved the survival of patients with non-small cell lung cancer (NSCLC). Still, many patients do not respond to these inhibitors. PD-L1 (CD274) expression, one

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service