Skip to Content
Merck
All Photos(1)

Key Documents

EHU081921

Sigma-Aldrich

MISSION® esiRNA

targeting human ACLY

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCCCATGGAGTTTGTGAACAAGATGAAGAAGGAAGGGAAGCTGATCATGGGCATTGGTCACCGAGTGAAGTCGATAAACAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAGGCAGCACTTCCCTGCCACTCCTCTGCTCGATTATGCACTGGAAGTAGAGAAGATTACCACCTCGAAGAAGCCAAATCTTATCCTGAATGTAGATGGTCTCATCGGAGTCGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAGGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGGTTCATTGGACACTATCTTGATCAGAAGAGGCTGAAGCAGGGGCTGTATCGTCATCCGTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ACLY(47) , ACLY(47)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mei Xin et al.
Oncotarget, 7(28), 44252-44265 (2016-06-19)
MicroRNAs (miRNAs) are non-coding small RNAs that function as negative regulators of gene expression involving in the tumor biology. ATP citrate lyase (ACLY), a key enzyme initiating de novo lipid synthesis, has been found to be upregulated in cancer cells
Supriya Shah et al.
Oncotarget, 7(28), 43713-43730 (2016-06-02)
The androgen receptor (AR) plays a central role in prostate tumor growth. Inappropriate reactivation of the AR after androgen deprivation therapy promotes development of incurable castration-resistant prostate cancer (CRPC). In this study, we provide evidence that metabolic features of prostate
Li Lai et al.
Circulation, 139(1), 119-133 (2018-12-28)
We have previously shown that activation of cell-autonomous innate immune signaling facilitates the transdifferentiation of fibroblasts into induced endothelial cells, and is required to generate induced endothelial cells with high fidelity for endothelial lineage. Recent studies indicate that a glycolytic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service