Skip to Content
Merck
All Photos(1)

Key Documents

EMU063601

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ntn1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACTGCCACTACTGCAAGGAGGGCTTCTACCGAGACATGGGCAAGCCTATCACCCACCGGAAGGCTTGCAAAGCCTGTGATTGCCACCCAGTGGGTGCTGCTGGCAAGACCTGCAATCAAACCACTGGCCAATGTCCCTGCAAGGACGGCGTGACGGGCATCACCTGCAACCGATGTGCCAAAGGCTACCAGCAGAGCCGTTCCCCCATCGCCCCTTGCATCAAGATTCCTGTGGCGCCGCCCACCACTGCAGCCAGCAGCGTGGAGGAACCGGAAGACTGTGATTCCTATTGCAAGGCCTCCAAAGGCAAGCTGAAGATGAACATGAAGAAATACTGCAGGAAGGACTATGCTGTCCAGATCCACATCCTGAAGGCCGACAAAGCAGGGGACTGGTGGAAGTTCACCGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ping Han et al.
American journal of cancer research, 5(4), 1396-1409 (2015-06-24)
The axon guidance cues netrin-1 has been reported to be associated with cancer progression in various types of human cancers. However, the underlying molecular mechanism of netrin-1-mediated metastasis remains obscure. In this study, we found that overexpression of netrin-1 promoted
Punithavathi Ranganathan et al.
Journal of cellular and molecular medicine, 18(7), 1290-1299 (2014-04-12)
The netrin-1 administration or overexpression is known to protect colon from acute colitis. However, the receptor that mediates netrin-1 protective activities in the colon during colitis remains unknown. We tested the hypothesis that UNC5B receptor is a critical mediator of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service