Skip to Content
Merck
All Photos(1)

Key Documents

EMU020771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Unc84a

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGAAGTGCGTCTCTCCAACTTGGAAGATGTTCTTAGAAAACTGACAGAAAAATCTGAGGCTATCCAGAAGGAGCTGGAAGAAACCAAGCTGAAAGCAGGCAGCAGGGATGAAGAGCAGCCCCTCCTTGACCGTGTGCAGCACCTAGAACTGGAACTGAACCTGTTGAAGTCACAGCTGTCAGACTGGCAGCATCTGAAGACCAGCTGTGAGCAGGCTGGGGCCCGCATCCAGGAGACTGTGCAGCTCATGTTCTCTGAGGATCAGCAGGGCGGTTCCCTCGAGTGGCTATTAGAGAAGCTTTCTTCTCGGTTCGTGAGCAAGGATGAGCTGCAGGTGCTCTTACATGACCTTGAGCTGAAACTGCTGCAGAATATCACACACCACATCACCGTGACAGGACAGGCCCCGACATCCGAGGCTATTGTGTCTGCCGTGAATCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hawa-Racine Thiam et al.
Nature communications, 7, 10997-10997 (2016-03-16)
Cell migration has two opposite faces: although necessary for physiological processes such as immune responses, it can also have detrimental effects by enabling metastatic cells to invade new organs. In vivo, migration occurs in complex environments and often requires a
Ping Li et al.
Nucleic acids research, 43(20), 9874-9888 (2015-10-18)
Nuclear export of messenger ribonucleoproteins (mRNPs) through the nuclear pore complex (NPC) can be roughly classified into two forms: bulk and specific export, involving an nuclear RNA export factor 1 (NXF1)-dependent pathway and chromosome region maintenance 1 (CRM1)-dependent pathway, respectively.
T Kuga et al.
Oncogenesis, 3, e94-e94 (2014-03-19)
The majority of human cancer shows chromosomal instability (CIN). Although the precise mechanism remains largely uncertain, proper progression of mitosis is crucial. B-type lamins were suggested to be components of the spindle matrix of mitotic cells and to be involved

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service