Skip to Content
Merck
All Photos(1)

Documents

EHU143331

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXO22

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCATTGGCTTCATGTTTGCATGCGTTGGCAGGGGCTTTCAGTATTACAGAGCCAAGGGGAATGTTGAGGCTGATGCATTTAGAAAGTTTTTTCCTAGTGTTCCCTTATTCGGCTTCTTTGGAAATGGAGAAATTGGATGTGATCGGATAGTCACTGGGAACTTTATATTGAGGAAATGTAATGAGGTAAAAGATGATGATCTGTTTCATAGCTATACAACAATAATGGCACTCATACATCTGGGGTCATCTAAATAATAATTAAAGTGGCTTTCATAATATGTAACTTTTGGGTTCTGCCTTTTTCAGAAAATGGAAACTTGGGCCATGTGTATTTCAAACAAAAATAACTTTAGATATATCTTTTTTGTAGCTTTGATTGATGCTCTAAGATCACATGAGGGTAGTATTTAATATATTAGATGAAGGACAACTTTGGACATAACACTGACTAGGAGTTGAGAGCTTTTGCATCAGGCAGAAGCAAACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xun-Kai Hou et al.
Biochemical and biophysical research communications, 523(3), 766-772 (2020-01-18)
Long noncoding RNA small nucleolus RNA host gene 14 (SNHG14) has been shown to exert oncogenic functions in seceral cancers, but its role in osteosarcoma still unclear. In this present study, we found that SNHG14 was significantly upregulated in osteosarcoma
Feng Guo et al.
International journal of biological sciences, 15(3), 647-656 (2019-02-13)
F-box only protein 22 (FBXO22), a substrate receptor of the SKP1-Cullin 1-F-box protein (SCF) E3 ubiquitin ligase that targets key regulators of cellular activities for ubiquitylation and degradation, plays important roles in the progression of human cancer. However, little is
Long Zhang et al.
Journal of experimental & clinical cancer research : CR, 38(1), 101-101 (2019-02-28)
Deregulation of ubiquitin ligases is related to the malignant progression of human cancers. F-box only protein 22 (FBXO22), an F-box E3 ligase, is a member of the F-box protein family. However, the biological function of FBXO22 in HCC and the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service