Skip to Content
Merck
All Photos(1)

Documents

EHU100971

Sigma-Aldrich

MISSION® esiRNA

targeting human PRC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACCAGCGGTTACAAAGAACTGAGGTGGTAAAGAAGCATATCAAGGAACTCCTGGATATGATGATTGCTGAAGAGGAAAGCCTGAAGGAAAGACTCATCAAAAGCATATCCGTCTGTCAGAAAGAGCTGAACACTCTGTGCAGCGAGTTACATGTTGAGCCATTTCAGGAAGAAGGAGAGACGACCATCTTGCAACTAGAAAAAGATTTGCGCACCCAAGTGGAATTGATGCGAAAACAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tianxiang Xu et al.
Cancer cell international, 20(1), 528-528 (2020-12-10)
Protein regulator of cytokinesis 1 (PRC1) has been reported to play important role in the pathogenesis of various cancers. However, its role in colon cancer has not been studied. Here, we aimed to investigate the biological functions and potential mechanism
Bin Zhang et al.
Journal of cellular and molecular medicine, 21(7), 1329-1341 (2017-02-13)
Gastric carcinoma is one of the most common malignancies worldwide and the second most frequent cause of cancer-related death in China. Protein regulator of cytokinesis 1 (PRC1) is involved in cytokinesis and plays key roles in microtubule organization in eukaryotes.
Melissa C Pamula et al.
The Journal of cell biology, 218(8), 2529-2544 (2019-06-30)
In the spindle midzone, microtubules from opposite half-spindles form bundles between segregating chromosomes. Microtubule bundles can either push or restrict chromosome movement during anaphase in different cellular contexts, but how these activities are achieved remains poorly understood. Here, we use

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service