Skip to Content
Merck
All Photos(1)

Documents

EHU091571

Sigma-Aldrich

MISSION® esiRNA

targeting human CADM1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGATGGGCAGAATCTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGTGACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCAATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATCACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAGATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Richard Hunte et al.
PLoS pathogens, 14(4), e1006968-e1006968 (2018-04-27)
Approximately 12% of all human cancers worldwide are caused by infections with oncogenic viruses. Kaposi's sarcoma herpesvirus/human herpesvirus 8 (KSHV/HHV8) is one of the oncogenic viruses responsible for human cancers, including Kaposi's sarcoma (KS), Primary Effusion Lymphoma (PEL), and the
Shu-Jun Wang et al.
Molecular medicine reports, 22(5), 3795-3803 (2020-10-02)
Melanoma is a malignant skin cancer type associated with a high mortality rate, but its treatment is currently not ideal. Both microRNA (miR)‑214 and cell adhesion molecule 1 (CADM1) are differentially expressed in melanoma, but their role in this cancer type
Hye-Ran Kim et al.
Frontiers in immunology, 11, 591054-591054 (2021-02-19)
A robust T-cell response is an important component of sustained antitumor immunity. In this respect, the avidity of TCR in the antigen-targeting of tumors is crucial for the quality of the T-cell response. This study reports that the transmembrane (TM)
Peter J Chockley et al.
The Journal of clinical investigation, 128(4), 1384-1396 (2018-01-13)
During epithelial-mesenchymal transition (EMT) epithelial cancer cells transdifferentiate into highly motile, invasive, mesenchymal-like cells, giving rise to disseminating tumor cells. Few of these disseminated cells successfully metastasize. Immune cells and inflammation in the tumor microenvironment were shown to drive EMT

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service