Skip to Content
Merck
All Photos(1)

Key Documents

EHU088121

Sigma-Aldrich

MISSION® esiRNA

targeting human PTBP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhi-Na Wang et al.
Oncotarget, 8(22), 36185-36202 (2017-04-14)
Polypyrimidine tract-binding protein 1 (PTBP1) involving in almost all steps of mRNA regulation including alternative splicing metabolism during tumorigenesis due to its RNA-binding activity. Initially, we found that high expressed PTBP1 and poor prognosis was interrelated in colorectal cancer (CRC)
Xin Fu et al.
Biochimica et biophysica acta. Molecular cell research, 1865(11 Pt A), 1552-1565 (2018-10-18)
Mesenchymal stem cells (MSCs) hold great promise as attractive vehicles to deliver therapeutic agents against cancer, while the cross-talk between MSCs and cancer cells remains controversial. Here in an indirect co-culture system we observed that MSCs induced the malignancy transformation
Hoin Kang et al.
The Journal of pathology, 249(3), 395-408 (2019-07-14)
Polypyrimidine tract-binding protein 1 (PTBP1) is one of the most investigated multifunctional RNA-binding proteins (RBP), controlling almost all steps of mRNA metabolism and processing. It has been reported that PTBP1 is overexpressed in many different types of cancer and this
Kohei Taniguchi et al.
International journal of molecular sciences, 19(5) (2018-04-27)
Pyruvate kinase is known as the glycolytic enzyme catalyzing the final step in glycolysis. In mammals, two different forms of it exist, i.e., pyruvate kinase M1/2 (PKM) and pyruvate kinase L/R (PKLR). Also, PKM has two isoforms, i.e., PKM1 and
Mohamed Sham Shihabudeen Haider Ali et al.
Nucleic acids research, 47(3), 1505-1522 (2018-11-27)
The role of long non-coding RNAs (lncRNAs) in regulating endothelial function through the DNA damage response (DDR) remains poorly understood. In this study, we demonstrate that lncRNA maternally expressed gene 3 (Meg3) interacts with the RNA binding protein polypyrimidine tract

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service