Skip to Content
Merck
All Photos(1)

Documents

EHU081951

Sigma-Aldrich

MISSION® esiRNA

targeting human WISP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACTAGGCAGGCACAAATCTTGGGTCTTGGGGACTAACCCAATGCCTGTGAAGCAGTCAGCCCTTATGGCCAATAACTTTTCACCAATGAGCCTTAGTTACCCTGATCTGGACCCTTGGCCTCCATTTCTGTCTCTAACCATTCAAATGACGCCTGATGGTGCTGCTCAGGCCCATGCTATGAGTTTTCTCCTTGATATCATTCAGCATCTACTCTAAAGAAAAATGCCTGTCTCTAGCTGTTCTGGACTACACCCAAGCCTGATCCAGCCTTTCCAAGTCACTAGAAGTCCTGCTGGATCTTGCCTAAATCCCAAGAAATGGAATCAGGTAGACTTTTAATATCACTAATTTCTTCTTTAGATGCCAAACCACAAGACTCTTTGGGTCCATTCAGATGAA

Ensembl | human accession no.

ENSG00000104415

NCBI accession no.

NM_080838

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... WISP1(8840) , WISP1(8840)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14507-14520 (2020-09-09)
Fibrosis is a pathological feature of chronic kidney disease and its progression correlates with declining renal function. Kidney fibrosis is driven by multiple profibrotic factors. This project examined the regulatory function of WNT1-inducible-signaling pathway protein 1 (WISP1) in the development
Jing-Yuan Chuang et al.
PloS one, 8(10), e78022-e78022 (2013-11-10)
Oral squamous cell carcinoma (OSCC) has a tendency to migrate and metastasize. WNT1-inducible signaling pathway protein 1 (WISP-1) is a cysteine-rich protein that belongs to the Cyr61, CTGF, Nov (CCN) family of matrix cellular proteins. The effect of WISP-1 on
Eun Kyung Jung et al.
Oncology letters, 14(2), 1719-1724 (2017-08-10)
WNT1-inducible-signaling pathway protein-1 (WISP-1) belongs to the family of cysteine rich 61/connective tissue growth factor/nephroblastoma overexpressed matricellular proteins, which are involved in various biological processes, including cell adhesion, proliferation, differentiation, angiogenesis and carcinogenesis. In the present study, the expression of
Xiaomin Zhang et al.
International journal of clinical and experimental pathology, 8(11), 15489-15496 (2016-01-30)
WISP1, a Wnt-induced secreted protein, has been found to have anticancer activity. ALL is a leading cause of death. Here we investigate the WISP1 effects on ALL Jurkat cells. Cell viability was assessed by CCK-8. Cell cycle and apoptosis were
Mitsuaki Ono et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 26(1), 193-208 (2010-08-05)
Wnt-induced secreted protein 1 (WISP-1/CCN4) is a member of the CCN family that is highly expressed in skeletal tissue and in osteoprogenitor cells induced to differentiate in vitro. To determine the function of WISP-1 during osteogeneis, osteogenic bone marrow stromal
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service