Skip to Content
Merck
All Photos(1)

Documents

EHU059231

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATTCCAAACCGGATGAGTGGTGAATGCCAATCCCCACACTGCCCTGGGACTAGTGCAGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCTGACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGCACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTCCACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAGCAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCCCGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAA

Ensembl | human accession no.

ENSG00000185345

NCBI accession no.

NM_013988

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PARK2(5071) , PARK2(5071)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Saburo Ito et al.
Autophagy, 11(3), 547-559 (2015-02-26)
Cigarette smoke (CS)-induced mitochondrial damage with increased reactive oxygen species (ROS) production has been implicated in COPD pathogenesis by accelerating senescence. Mitophagy may play a pivotal role for removal of CS-induced damaged mitochondria, and the PINK1 (PTEN-induced putative kinase 1)-PARK2
Zhengjun Gao et al.
Nature communications, 8(1), 1805-1805 (2017-11-29)
Macrophages, dendritic cells and other innate immune cells are involved in inflammation and host defense against infection. Metabolic shifts in mitochondrial dynamics may be involved in Toll-like receptor agonist-mediated inflammatory responses and immune cell polarization. However, whether the mitochondrial morphology
Vinay Choubey et al.
Autophagy, 10(6), 1105-1119 (2014-06-01)
The autophagy protein BECN1/Beclin 1 is known to play a central role in autophagosome formation and maturation. The results presented here demonstrate that BECN1 interacts with the Parkinson disease-related protein PARK2. This interaction does not require PARK2 translocation to mitochondria
Shu Li et al.
Free radical biology & medicine, 152, 632-649 (2019-12-12)
Mitophagy is a principle mechanism to degrade damaged mitochondria through PARK2-dependent or PARK2-independent pathway. Mitophagy has been identified to play an important role in acute kidney disease, whereas its role in renal fibrosis remains ill-defined. We sought to investigate the
Pedro Elói Antunes Dionísio et al.
Molecular neurobiology, 56(4), 2990-3004 (2018-08-04)
Parkin is an E3 ubiquitin ligase involved in Parkinson's disease (PD). Necroptosis is a regulated form of cell death that depends on receptor interacting protein 1 (RIP1) and 3 (RIP3). Importantly, parkin has been implicated in ubiquitination events that can

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service