Skip to Content
Merck
All Photos(1)

Key Documents

EHU008861

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGCAATGGGAACATAGCCCTTTGGGAGAGTTGTGTCCACCAGGATCTCATAGATCAGAACATCCTGGAGCCTGTAACCGGTGCACAGAGGGTGTGGGTTACACCAATGCTTCCAACAATTTGTTTGCTTGCCTCCCATGTACAGCTTGTAAATCAGATGAAGAAGAGAGAAGTCCCTGCACCACGACCAGGAACACAGCATGTCAGTGCAAACCAGGAACTTTCCGGAATGACAATTCTGCTGAGATGTGCCGGAAGTGCAGCAGAGGGTGCCCCAGAGGGATGGTCAAGGTCAAGGATTGTACGCCCTGGAGTGACATCGAGTGTGTCCACAAAGAATCAGGCAATGGACATAATATATGGGTGATTTTGGTTGTGACTTTGGTTGTTCCGTTGCTGTTGGTGGCTGTGCTGATTGTCTGTTGTTGCATCGGCTCAGGTTGTGGAGGGGACCCCAAGTGCATGGACAGGGTGTGTTTCTGGCGCTTGGGTCTCCTACGAGGGCCTGGGGCTGAGGACAATGCTCACAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yitong Yang et al.
The international journal of biochemistry & cell biology, 97, 62-72 (2018-02-13)
Persistent infection with hepatitis B virus (HBV) may lead to HBV-associated glomerulonephritis (HBV-GN). Presence of HBV-DNA and -RNA in renal tubular epithelial cells (RTECs) suggests direct virus-induced injury. Increase in proinflammatory cytokines is also observed under these conditions. Apoptosis by
Yuyou Deng et al.
International journal of biological sciences, 15(3), 688-700 (2019-02-13)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an effective chemotherapeutic agent that specifically impairs cancer cells while sparing normal cells; however, some cancer cells develop resistance to TRAIL. Here, we identified Andrographolide, a diterpenoid lactone derived from a traditional herbal
Bo Ram Kim et al.
Oncogene, 38(20), 3903-3918 (2019-01-30)
RUNX3 is frequently inactivated by DNA hypermethylation in numerous cancers. Here, we show that RUNX3 has an important role in modulating apoptosis in immediate response to tumor necrosis factor-related apoptosis-including ligand (TRAIL). Importantly, no combined effect of TRAIL and RUNX3
Jae Young Jang et al.
PloS one, 9(6), e98171-e98171 (2014-06-14)
Hepatitis C virus (HCV) infection causes chronic liver diseases leading to hepatocellular carcinoma (HCC) and liver failure. We have previously shown that HCV sensitizes hepatocytes to mitochondrial apoptosis via the TRAIL death receptors DR4 and DR5. Although TRAIL and its
Mamoru Akita et al.
International journal of oncology, 45(5), 1901-1912 (2014-09-02)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising candidate for cancer treatment, but some cancer cell types are resistant to TRAIL cytotoxicity. Therefore, overcoming this resistance is necessary for effective TRAIL therapy. Mitochondrial morphology is important for the maintenance

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service