Skip to Content
Merck
All Photos(1)

Key Documents

EHU034121

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCG

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAGGACGTGATCGTCCAGGACGACGATGTGGACTGCACGCTGGTGGAGAAACGTGTGCTGGCGCTGGGGGGCCGGGGTCCTGGCGGCCGGCCCCACTTCCTCACCCAGCTCCACTCCACCTTCCAGACCCCGGACCGCCTGTATTTCGTGATGGAGTACGTCACCGGGGGAGACTTGATGTACCACATTCAACAGCTGGGCAAGTTTAAGGAGCCCCATGCAGCGTTCTACGCGGCAGAAATCGCTATCGGCCTCTTCTTCCTTCACAATCAGGGCATCATCTACAGGGACCTGAAGCTGGACAATGTGATGCTGGATGCTGAGGGACACATCAAGATCACTGACTTTGGCATGTGTAAGGAGAACGTCTTCCCCGGGACGACAACCCGCACCTTCTGCGGGACCCCGGACTACATAGCCCCGGAGATCATTGCCTACCAGCCCTATGGGAAGTCTGTCGATTGGTGGTCCT

Ensembl | human accession no.

ENSG00000126583

NCBI accession no.

NM_002739

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRKCG(5582) , PRKCG(5582)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Juan Carlos Montero et al.
Oncotarget, 7(47), 77937-77949 (2016-10-28)
P-Rex proteins are guanine nucleotide exchange factors (GEFs) that act on the Rho/Rac family of GTP binding proteins. The activity of P-Rex proteins is regulated by several extracellular stimuli. In fact, activation of growth factor receptors has been reported to
Ke Wu et al.
Antioxidants & redox signaling, 30(17), 1983-1998 (2018-05-29)
Aims: Epidemiologic evidence indicates that diabetes may increase risk of breast cancer (BC) and mortality in patients with cancer.
Mi Yeong Kim et al.
Scientific reports, 9(1), 7044-7044 (2019-05-09)
c-Fms is the macrophage colony-stimulating factor (M-CSF) receptor, and intracellular signalling via the M-CSF/c-Fms axis mediates both innate immunity and bone remodelling. M-CSF-induced transient proteolytic degradation of c-Fms modulates various biological functions, and protein kinase C (PKC) signalling is activated
Molly Butts et al.
Nutrients, 11(10) (2019-10-23)
Malnutrition is present in chronic alcoholics. However, how moderate alcohol consumption affects the absorption of nutrients like glutamine has not been investigated. Glutamine, an amino acid, is vital to gastrointestinal health. Glutamine is absorbed via sodium-dependent glutamine co-transport (B0AT1; SLC6A19)
Yoon Kyung Choi
Archives of pharmacal research, 40(12), 1433-1442 (2017-10-13)
Treatment of human retinal microvascular endothelial cells (HRMECs) with vascular endothelial growth factor 165 (VEGF
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service