Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU124431

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCCCAGCAGTCTCTTACCTTCCCTGATCTTTGCAGGGTGGTCCGTGTAAATAGTATAAATTCTCCAAATTATCCTCTAATTATAAATGTAAGCTTATTTCCTTAGATCATTATCCAGAGACTGCCAGAAGGTGGGTAGGATGACCTGGGGTTTCAATTGACTTCTGTTCCTTGCTTTTAGTTTTGATAGAAGGGAAGACCTGCAGTGCACGGTTTCTTCCAGGCTGAGGTACCTGGATCTTGGGTTCTTCACTGCAGGGACCCAGACAAGTGGATCTGCTTGCCAGAGTCCTTTTTGCCCCTCCCTGCCACCTCCCCGTGTTTCCAAGTCAGCTTTCCTGCAAGAAGAAATCCTGGTTAAAAAAGTCTTTTGTATTGGGTCAGGAGTTGAATTTGGGGTGGGAGGATGGATGCAACTGAAGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Paweena Dana et al.
Cellular oncology (Dordrecht), 43(2), 211-222 (2019-11-16)
Cholangiocarcinoma (CCA) is an aggressive type of cancer. The major obstacles for treatment are its late presentation and the occurrence metastases. Targeting the metastatic process may serve as a treatment option. CD147 is a membrane protein that promotes CCA metastasis.
Xiaocheng Cao et al.
Journal of oncology, 2020, 8978930-8978930 (2020-04-21)
Whether DNA methyltransferase 1 (DNMT1)/miR-34a/FoxM1 signaling promotes the stemness of liver cancer stem cells (LCSCs) remains unclear. This study aimed to assess whether methylation-based silencing of miR-34a by DNMT1 contributes to stemness features via FoxM1 upregulation in LCSCs. The CD133+
Ying Z Mazzu et al.
Molecular oncology, 13(9), 1944-1958 (2019-06-22)
Epigenetic silencing of miRNA is a primary mechanism of aberrant miRNA expression in cancer, and hypermethylation of miRNA promoters has been reported to contribute to prostate cancer initiation and progression. Recent data have shown that the miR-193b promoter is hypermethylated
Qiyan Hu et al.
Oncology letters, 15(6), 10063-10069 (2018-06-22)
Cervical cancer is the second most common type of cancer in females worldwide. It has been demonstrated that microRNAs (miRs) serve important roles in the occurrence and development of various types of cancer, including cervical cancer. The results of the
Wen-Lung Su et al.
Cancer biomarkers : section A of Disease markers, 28(3), 341-350 (2020-05-12)
Effective prognostic biomarkers and powerful target-therapeutic drugs are needed for improving the treatment of Hepatocellular carcinoma (HCC). This study aimed to evaluate the expression of FOXM1 and Aurora-A and their prognostic value in HCC. We determined the differentially expressed genes

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico