Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU081751

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM1L

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTGCCAGGAATGACCAAGGTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGAGAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCTAATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATGGTCGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAGGAGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAA

Ensembl | nº de acceso humano

ENSG00000087470

Nº de acceso NCBI

NM_005690

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DNM1L(10059) , DNM1L(10059)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
AEV
IBV
LVU
FMU
YFT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Unbin Chae et al.
Bioscience, biotechnology, and biochemistry, 83(3), 409-416 (2018-11-27)
Microglial activation is known to be an important event during innate immunity, but microglial inflammation is also thought to play a role in the etiology of neurodegenerative diseases. Recently, it was reported that autophagy could influence inflammation and activation of
Nicole L Mancini et al.
Cellular and molecular gastroenterology and hepatology, 11(2), 551-571 (2020-09-30)
Adherent-invasive Escherichia coli are implicated in inflammatory bowel disease, and mitochondrial dysfunction has been observed in biopsy specimens from patients with inflammatory bowel disease. As a novel aspect of adherent-invasive E coli-epithelial interaction, we hypothesized that E coli (strain LF82)
Maria Manczak et al.
Human molecular genetics, 28(2), 177-199 (2018-09-22)
The purpose of our study was to better understand the effects of mitochondrial-division inhibitor 1 (Mdivi-1) on mitochondrial fission, mitochondrial biogenesis, electron transport activities and cellular protection. In recent years, researchers have found excessive mitochondrial fragmentation and reduced fusion in
Dongjoon Kim et al.
Cells, 9(7) (2020-07-16)
Diabetic retinopathy is a prevalent microvascular complication characterized by apoptotic vascular cell loss in the retina. Previous studies have shown that high glucose (HG)-induced mitochondrial fragmentation plays a critical role in promoting retinal vascular cell apoptosis. Here, we investigated whether
S Xu et al.
Cell death & disease, 4, e540-e540 (2013-03-16)
Mitochondria are critical targets in the hepatotoxicity of cadmium (Cd). Abnormal mitochondrial dynamics have been increasingly implicated in mitochondrial dysfunction in pathophysiological conditions. Therefore, our study aimed to investigate the effects and underlying mechanism of Cd on mitochondrial dynamics during
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico