Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU058911

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACCTCCTGTGAGCGAGAGTGATGATGGCTTCAGCATACACAATGCTACACTGCAGTCACACACACTGGCAGACTCCATCCCCAGCAGCCCTGCTTCTTCACAGTTCTCTGTCTGTAGTGAGGATCAGGAAGCTATTCAGGCACAGAAAATTTGGAAGAAAGCCATCATGCTTGTATGGAGAGCTGCAGCTAATCATAGGTATGCCAATGTCTTCCTGCAGCCTGTTACAGATGACATAGCACCTGGCTACCACAGCATTGTGCAGAGGCCTATGGATTTGTCAACTATTAAGAAAAACATAGAAAATGGACTGATCCGAAGCACAGCTGAATTTCAGCGTGACATTATGCTGATGTTTCAGAATGCTGTAATGTACAATAGCTCAGACCATGATGTCTATCACATGGCAGTGGAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anahita Lashgari et al.
Scientific reports, 8(1), 14089-14089 (2018-09-22)
Regulation of the chromatin state is crucial for biological processes such as the regulation of transcription, DNA replication, and DNA damage repair. Here we show that knockdown of the BRD8 bromodomain protein - a subunit of the p400/Tip60 complex -
Zhaoxiang Yu et al.
Archives of biochemistry and biophysics, 693, 108550-108550 (2020-08-30)
Bromodomain-containing 8 (BRD8), which belongs to the histone acetyl transferase (HAT) complex, functions as a driver in colorectal cancer. However, the role of BRD8 and its related regulatory mechanisms in hepatocellular carcinoma (HCC) remain unexplored. In this study, we found
Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico