Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU043571

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCACCATGTGGTCCTCAGATGAAAAAAAAGATATTGACCATGAGACAGTGGTTGAAGAACAGATCATTGGAGAGAACTCACCTCCTGATTATTCAGAATATATGACAGGAAAGAAACTTCCTCCTGGAGGAATACCTGGCATTGACCTCTCAGATCCCAAACAACTGGCAGAATTTGCTAGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCA

Ensembl | human accession no.

ENSG00000100811

NCBI accession no.

NM_003403

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... YY1(7528) , YY1(7528)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiyeon Choi et al.
Nature communications, 11(1), 2718-2718 (2020-06-03)
Genome-wide association studies (GWAS) have identified ~20 melanoma susceptibility loci, most of which are not functionally characterized. Here we report an approach integrating massively-parallel reporter assays (MPRA) with cell-type-specific epigenome and expression quantitative trait loci (eQTL) to identify susceptibility genes/variants
Jinpiao Lin et al.
Journal of autoimmunity, 77, 67-75 (2016-11-11)
Previous studies have revealed a critical role of YY1, a "Yin Yang" transcription factor, in cancer development and progression. However, whether YY1 has any role in rheumatoid arthritis (RA) remains unknown. This study aims to explore the potential role of
Heekyoung Lee et al.
Nucleic acids research, 45(6), 3266-3279 (2017-03-24)
Genome-wide association studies identified numerous disease risk loci. Delineating molecular mechanisms influenced by cis-regulatory variants is essential to understand gene regulation and ultimately disease pathophysiology. Combining bioinformatics and public domain chromatin information with quantitative proteomics supports prediction of cis-regulatory variants
Hang Song et al.
Clinical and translational medicine, 10(7), e220-e220 (2020-12-01)
Growing evidences have been revealing that long noncoding RNAs are vital factors in oncogenesis and tumor development. Among them, cancer susceptibility candidate 11 (CASC11) has displayed an impressively essential role in various kinds of cancers including hepatocellular carcinoma (HCC). Nevertheless
Xin-Chun Zhang et al.
Biochemical and biophysical research communications, 502(2), 269-275 (2018-05-29)
Neuroinflammation plays a critical role in the process of neurodegenerative disorders, during which microglia, the principal resident immune cells in the central nervous system, are activated and produce proinflammatory mediators. Yin-Yang 1 (YY1), a multi-functional transcription factor, is widely expressed
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico