Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU022531

Sigma-Aldrich

MISSION® esiRNA

targeting human ULK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGAACCTCGCCAAGTCTCAGACGCTGCTGGGGAAGGAAATCAAAATCCTGAAGGAACTGAAACATGAAAACATCGTGGCCCTGTACGACTTCCAGGAAATGGCTAATTCTGTCTACCTGGTTATGGAGTACTGCAACGGTGGGGACCTGGCCGACTACCTGCACGCCATGCGCACGCTGAGCGAGGACACCATCAGGCTCTTCCTGCAGCAGATCGCGGGCGCCATGCGGCTTCTGCACAGCAAAGGCATCATCCACCGCGACCTGAAACCGCAGAACATCCTGCTGTCCAACCCCGCCGGCCGCCGCGCCAACCCCAACAGCATCCGCGTCAAGATCGCTGACTTCGGCTTCGCGCGGTACCTCCAGAGCAACATGATGGCGGCCACACTCTGCGGCTCCCCCATGTACATGGCCCCCGAGGTCATCATGTCCCAGCACTACGACGGGAAGGCGGACCTGTGGAGCATCGGCACCATCGTCTACCAGTGCCTGA

Ensembl | nº de acceso humano

ENSG00000177169

Nº de acceso NCBI

NM_003565

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ULK1(8408) , ULK1(8408)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
CEV
KDV
OUT
CIT
EFT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Katrin Spengler et al.
Cells, 9(3) (2020-03-15)
AMP-activated protein kinase (AMPK) is activated by vascular endothelial growth factor (VEGF) in endothelial cells and it is significantly involved in VEGF-induced angiogenesis. This study investigates whether the VEGF/AMPK pathway regulates autophagy in endothelial cells and whether this is linked
Min Liu et al.
Toxicology letters, 283, 106-115 (2017-11-13)
Mitochondrial aldehyde dehydrogenase 2 (ALDH2), an important enzyme in the elimination of toxic aldehydes, is involved in cardioprotection against diabetes mellitus. This study was designed to examine the mechanism behind ALDH2-offered protection against high glucose exposure with a focus on
Shan Zhu et al.
Autophagy, 9(3), 317-327 (2012-12-18)
IFN1@ (interferon, type 1, cluster, also called IFNα) has been extensively studied as a treatment for patients with chronic myeloid leukemia (CML). The mechanism of anticancer activity of IFN1@ is complex and not well understood. Here, we demonstrate that autophagy
Qiang Xiao et al.
Theranostics, 10(22), 10245-10261 (2020-09-16)
Hepatocellular carcinoma (HCC) is the third most frequent cause of cancer-related deaths globally because of high metastasis and recurrence rates. Elucidating the molecular mechanisms of HCC recurrence and metastasis and developing effective targeted therapies are expected to improve patient survival.
Tiejian Nie et al.
Cell death & disease, 7(12), e2563-e2563 (2016-12-30)
Endoplasmic reticulum (ER) stress is involved in many cellular processes. Emerging evidence suggests that ER stress can trigger autophagy; however, the mechanisms by which ER stress regulates autophagy and its role in this condition are not fully understood. HIV Tat-interactive
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico