Skip to Content
Merck
All Photos(1)

Key Documents

EHU023381

Sigma-Aldrich

MISSION® esiRNA

targeting human FFAR2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTGGTGCTCTTCTTCATCCCCATGGCAGTCACCATCTTCTGCTACTGGCGTTTTGTGTGGATCATGCTCTCCCAGCCCCTTGTGGGGGCCCAGAGGCGGCGCCGAGCCGTGGGGCTGGCTGTGGTGACGCTGCTCAATTTCCTGGTGTGCTTCGGACCTTACAACGTGTCCCACCTGGTGGGGTATCACCAGAGAAAAAGCCCCTGGTGGCGGTCAATAGCCGTGGTGTTCAGTTCACTCAACGCCAGTCTGGACCCCCTGCTCTTCTATTTCTCTTCTTCAGTGGTGCGCAGGGCATTTGGGAGAGGGCTGCAGGTGCTGCGGAATCAGGGCTCCTCCCTGTTGGGACGCAGAGGCAAAGACACAGCAGAGGGGACAAATGAGGACAGGGGTGTGGGTCAAGGAGAAGGGATGCCAAGT

Ensembl | human accession no.

ENSG00000126262

NCBI accession no.

NM_005306

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FFAR2(2867) , FFAR2(2867)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Laure B Bindels et al.
British journal of cancer, 117(9), 1336-1340 (2017-09-06)
Activation of free fatty acid receptor 2 (FFAR2) by microbiota-derived metabolites (e.g., propionate) reduces leukaemic cell proliferation in vitro. This study aims to test whether Ffar2 expression per se also influences leukaemia cell growth in vivo. Bcr-Abl-expressing BaF cells were
Hiroki Yoshida et al.
Archives of biochemistry and biophysics, 672, 108057-108057 (2019-07-30)
Short-chain fatty acids (SCFAs) such as acetate, propionate, and butyrate are generated by gut microbial fermentation of dietary fiber. SCFAs may exert multiple beneficial effects on human lipid and glucose metabolism. However, their actions and underlying mechanisms are not fully
Guangwen Wang et al.
Journal of virology, 94(2) (2019-11-07)
Influenza A virus (IAV) coopts numerous host factors to complete its replication cycle. Here, we identify free fatty acid receptor 2 (FFAR2) as a cofactor for IAV entry into host cells. We found that downregulation of FFAR2 or Ffar2 expression

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service