Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU177661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Insr

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCTGCAGATCCTCCTGATGTTCAAGACCAGACCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACAGATTACCTGCTTCTCTTCCGTGTCTATGGTCTGGAAAGTCTGAAAGACCTCTTCCCAAATCTCACAGTCATCCGAGGCTCCCGTCTCTTCTTCAACTATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATGAACATCACCCGGGGCTCTGTCCGCATCGAGAAGAATAATGAGCTCTGCTACCTGGCCACTATCGACTGGTCCCGTATCCTGGATTCTGTGGAGGACAACTACATTGTACTGAACAAAGATGACAACGAGGAATGTGGGGATGTCTGTCCAGGCACCGCCAAGGGCAAGACCAACTGTCCTGCCACTGTCATCAATGGGCAGTTTGTGGAACGGTGCTGGACACACAGTCATTGTCAGAAAGTTTGCCCAACCATCTGTAAGTCACATGGCTGCACAG

Ensembl | nº de acceso | ratón

ENSMUSG00000005534

Nº de acceso NCBI

NM_010568

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... INSR(16337) , Insr(16337)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DAU
KWT
BPT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Ingrit Hamann et al.
Archives of biochemistry and biophysics, 558, 42-50 (2014-06-17)
Copper ions are known to induce insulin-like effects in various cell lines, stimulating the phosphoinositide 3'-kinase (PI3K)/Akt signaling cascade and leading to the phosphorylation of downstream targets, including FoxO transcription factors. The aim of this work was to study the
Isabel Heidegger et al.
Oncotarget, 5(9), 2723-2735 (2014-05-09)
We scrutinized the effect of insulin receptor (INSR) in addition to IGF1R in PCa using in vitro and in vivo models. In-vitro overexpression of IGF1R and INSRA, but not INSRB increased cell proliferation, colony formation, migration, invasion and resistance to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico