Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU125021

Sigma-Aldrich

MISSION® esiRNA

targeting human GYPC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGGAGGTGGGAGAAAATCTGGGCACATGGGGCCCCCTGGGCAGTGCAGGACAACATCAGCTCACTGGCAGGAAAGTCCTTGTTGAGGGTGAGGGGGTGCTGGGGTACCCGGGGGCTGGGGAAGCAAGGAAATAAGTCATCTGTATGCTGACTGGGGATAATGGCATCAAATGTCAGTCCTTGACATTTGGGGGGAACAGCAGGTGCCAGAGCTAAAAGG

Ensembl | nº de acceso humano

ENSG00000136732

Nº de acceso NCBI

NM_002101

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GYPC(2995) , GYPC(2995)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie Liu et al.
Hepatology (Baltimore, Md.), 69(4), 1535-1548 (2018-12-07)
Endocannabinoids promote energy conservation in obesity, whereas cannabinoid-1 receptor (CB1 R) blockade reverses body weight gain and insulin resistance and increases energy expenditure. Here we investigated the molecular mechanisms of the catabolic effects of CB1 R blockade in the liver.
Weiwei Cheng et al.
Neuron, 104(5), 885-898 (2019-10-08)
Hexanucleotide GGGGCC repeat expansion in C9ORF72 is the most prevalent genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). One pathogenic mechanism is the aberrant accumulation of dipeptide repeat (DPR) proteins produced by the unconventional translation of expanded RNA repeats.
Charles A Berdan et al.
Cell chemical biology, 26(7), 1027-1035 (2019-05-14)
Parthenolide, a natural product from the feverfew plant and member of the large family of sesquiterpene lactones, exerts multiple biological and therapeutic activities including anti-inflammatory and anti-cancer effects. Here, we further study the parthenolide mechanism of action using activity-based protein
Arif Yurdagul et al.
Cell metabolism, 31(3), 518-533 (2020-02-01)
Continual efferocytic clearance of apoptotic cells (ACs) by macrophages prevents necrosis and promotes injury resolution. How continual efferocytosis is promoted is not clear. Here, we show that the process is optimized by linking the metabolism of engulfed cargo from initial
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico