Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU111851

Sigma-Aldrich

MISSION® esiRNA

targeting human USP8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAATTTGTTGGGGCATAAAGGTGAAGTGGCAGAAGAATTTGGTATAATCATGAAAGCCCTGTGGACAGGACAGTATAGATATATCAGTCCAAAGGACTTTAAAATCACCATTGGGAAGATCAATGACCAGTTTGCAGGATACAGTCAGCAAGATTCACAAGAATTGCTTCTGTTCCTAATGGATGGTCTCCATGAAGATCTAAATAAAGCTGATAATCGGAAGAGATATAAAGAAGAAAATAATGATCATCTCGATGACTTTAAAGCTGCAGAACATGCCTGGCAGAAACACAAGCAGCTCAATGAGTCTATTATTGTTGCACTTTTTCAGGGTCAATTCAAATCTACAGTACAGTGCCTCACATGTCACAAAAAGTCTAGGACATTTGAGGCCTTCATG

Ensembl | human accession no.

ENSG00000138592

NCBI accession no.

NM_005154

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... USP8(9101) , USP8(9101)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jinghui Zhang et al.
Biochimica et biophysica acta. General subjects, 1864(12), 129701-129701 (2020-08-21)
Background Organic anion transporter 1 (OAT1) plays a vital role in avoiding the potential toxicity of various anionic drugs through the involvement of kidney elimination. We previously demonstrated that ubiquitin conjugation to OAT1 led to OAT1 internalization from cell surface
Tania Martins-Marques et al.
Life science alliance, 3(12) (2020-10-25)
Ischemic heart disease has been associated with an impairment on intercellular communication mediated by both gap junctions and extracellular vesicles. We have previously shown that connexin 43 (Cx43), the main ventricular gap junction protein, assembles into channels at the extracellular
Soyeon Shin et al.
Cell death and differentiation, 27(4), 1341-1354 (2019-09-19)
Notch, an essential factor in tissue development and homoeostasis, has been reported to play an oncogenic function in a variety of cancers. Here, we report ubiquitin-specific protease 8 (USP8) as a novel deubiquitylase of Notch1 intracellular domain (NICD). USP8 specifically
Hong Peng et al.
Autophagy, 16(4), 698-708 (2019-06-27)
SQSTM1/p62 (sequestosome 1) is a critical macroautophagy/autophagy receptor that promotes the formation and degradation of ubiquitinated aggregates. SQSTM1 can be modified by ubiquitination, and this modification modulates its autophagic activity. However, the molecular mechanisms underpinning its reversible deubiquitination have never

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico