Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU093591

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAACTGGGAAGCTTGATGGACCAGACAAATAGGATGATGGCTGCCCCCACACAATAAATGGTAACATAGGAGACATCCACATCCCAATTCTGACAAGACCTCATGCCTGAAGACAGCTTGGGCAGGTGAAACCAGAATATGTGAACTGAGTGGACACCCGAGGCTGCCACTGGAATGTCTTCTCAGGCCATGAGCTGCAGTGACTGGTAGGGCTGTGTTTACAGTCAGGGCCACCCCGTCACATATACAAAGGAGCTGCCTGCCTGTTTGCTGTGTTGAACTCTTCACTCTGCTGAAGCTCCTAATGGAAAAAGCTTTCTTCTGACTGTGACCCTCTTGAACTGAATCAGACCAACTGGAATCCCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Application

MISSION® esiRNA has been used for transfection of cells to target SIRT3.

Biochem/physiol Actions

SIRT3 (sirtuin 3) is a mitochondrial deacetylase, which acts as an oncogene. It is associated with the initiation and progression of certain cancers. However, in some cases it also works anti-oncogenically. It plays a major role in mitochondrial activity via deacetylating proteins associated with energy metabolism, ATP generation, redox optimization, and mitochondrial biogenesis. It is also involved in transcription, insulin secretion and apoptosis. Deacetylation of cyclophilin-D via SIRT3 inhibits age-associated cardiac hypertrophy. SIRT3 also exhibits neuroprotective roles.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lorissa J Smulan et al.
mBio, 12(1) (2021-02-04)
Mycobacterium tuberculosis induces metabolic reprogramming in macrophages like the Warburg effect. This enhances antimicrobial performance at the expense of increased inflammation, which may promote a pathogen-permissive host environment. Since the NAD+-dependent protein deacetylase Sirtuin 3 (SIRT3) is an important regulator
Marija Pinterić et al.
Antioxidants (Basel, Switzerland), 9(4) (2020-04-05)
Estrogen (E2) is a major risk factor for the initiation and progression of malignancy in estrogen receptor (ER) positive breast cancers, whereas sirtuin 3 (Sirt3), a major mitochondrial NAD+-dependent deacetylase, has the inhibitory effect on the tumorigenic properties of ER
Pro-Proliferative Function of Mitochondrial Sirtuin Deacetylase SIRT3 in Human Melanoma.
George J
The Journal of Investigative Dermatology, 136, 809-809 (2016)
Xiaokan Zhang et al.
Circulation, 137(19), 2052-2067 (2018-01-14)
Heart failure leads to mitochondrial dysfunction and metabolic abnormalities of the failing myocardium coupled with an energy-depleted state and cardiac remodeling. The mitochondrial deacetylase sirtuin 3 (SIRT3) plays a pivotal role in the maintenance of mitochondrial function through regulating the
SIRT3 is correlated with the malignancy of non-small cell lung cancer.
Xiong Y, et. al.
International Journal of Oncology, 50, 903-903 (2017)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico