Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU057111

Sigma-Aldrich

MISSION® esiRNA

targeting human MSH3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTGTGATTGATGTGTTGCTGGGAGAACAGGATCAATATGTCCCAAATAATACAGATTTATCAGAGGACTCAGAGAGAGTAATGATAATTACCGGACCAAACATGGGTGGAAAGAGCTCCTACATAAAACAAGTTGCATTGATTACCATCATGGCTCAGATTGGCTCCTATGTTCCTGCAGAAGAAGCGACAATTGGGATTGTGGATGGCATTTTCACAAGGATGGGTGCTGCAGACAATATATATAAAGGACAGAGTACATTTATGGAAGAACTGACTGACACAGCAGAAATAATCAGAAAAGCAACATCACAGTCCTTGGTTATCTTGGATGAACTAGGAAGAGGGACGAGCACTCATGATGGAATTGCCATTGCCTATGCTACACTTGAGTATTTCATCAGAGATGTGAAATCCTTAACCCTGTTTGTCACCCATTATCCGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome
Sarah J Young et al.
Cell reports, 33(3), 108289-108289 (2020-10-22)
MutSα and MutSβ play important roles in DNA mismatch repair and are linked to inheritable cancers and degenerative disorders. Here, we show that MSH2 and MSH3, the two components of MutSβ, bind SLX4 protein, a scaffold for the assembly of
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico