Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU034701

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK1 (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGC

Ensembl | nº de acceso humano

ENSG00000067900

Nº de acceso NCBI

NM_005406

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ROCK1(6093) , ROCK1(6093)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
QCS
ZUT
MET
HDT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gentao Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1167-1177 (2019-05-29)
miR-139 has a tumor suppressor effect in many tumors. Here, we examined the suppressive role of this miRNA and its target, ROCK1, in osteosarcoma (OS), a highly malignant bone tumor that mainly affects children and adolescents. The expression of miR-139
Jialing Rao et al.
Scientific reports, 7, 39727-39727 (2017-01-06)
A recent study demonstrated that advanced glycation end products (AGEs) play a role in monocyte infiltration in mesangial areas in diabetic nephropathy. The Ras homolog gene family, member A Rho kinase (RhoA/ROCK) pathway plays a role in regulating cell migration.
Dongmei Wang et al.
OncoTargets and therapy, 13, 361-370 (2020-02-06)
Propofol has been identified to perform anti-tumor functions in glioma. However, the molecular mechanisms underlying propofol-induced prevention on migration and invasion of glioma cells remain unclear. Cell proliferation, invasion and migration were measured by 3-(4,5)-dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide assay and transwell assay, respectively.
Wen-Di Zhou et al.
International journal of oncology, 51(6), 1831-1841 (2017-10-19)
Actein is a tetracyclic triterpenoid compound, extracted from the rhizome of Cimicifuga foetida, exhibiting anticancer activities as previously reported. However, the effects of actein on human leukemia have not been explored before. In this study, the role of actein in
Ji-Gang Zhang et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1113-1125 (2019-02-20)
Vasculogenic mimicry (VM) results in the formation of an alternative circulatory system that can improve the blood supply to multiple malignant tumors, including hepatocellular carcinoma (HCC). However, the potential mechanisms of RhoC/ROCK in VM have not yet been investigated in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico