Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU031731

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCGAGTATTCGTCAACCAGTTATATCAGCCAAGTTTGGAGCGAGAAGTCAGTAAAAATCCAGATTTGCAGGCCATCCGAATTGCTTCTGTGAACCCCATCCTAGACCCCTGGATATATATCCTCCTGAGAAAGACAGTGCTCAGTAAAGCAATAGAGAAGATCAAATGCCTCTTCTGCCGCATTGGCGGGTCCCGCAGGGAGCGCTCCGGACAGCACTGCTCAGACAGTCAAAGGACATCTTCTGCCATGTCAGGCCACTCTCGCTCCTTCATCTCCCGGGAGCTGAAGGAGATCAGCAGTACATCTCAGACCCTCCTGCCAGACCTCTCACTGCCAGACCTCAGTGAAAATGGCCTTGGAGGCAGGAATTTGCTTCCAGGTGTGCCTGGCATGGGCCTGGCCCAGGAAGACACCACCTCACTGAGGACTTTGCGAATATCAGAGACCTCAGACTCTTCACAGGGTCAGGACTCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Felix Tönisen et al.
European journal of cell biology, 96(2), 218-226 (2017-01-18)
The production of Prostaglandin E
Pinki Nandi et al.
BMC cancer, 17(1), 11-11 (2017-01-07)
Lymphatic metastasis, facilitated by lymphangiogenesis is a common occurrence in breast cancer, the molecular mechanisms remaining incompletely understood. We had earlier shown that cyclooxygenase (COX)-2 expression by human or murine breast cancer cells promoted lymphangiogenesis and lymphatic metastasis by upregulating
Sonja Rittchen et al.
Biochemical pharmacology, 182, 114277-114277 (2020-10-11)
Life-threatening inflammatory conditions such as acute respiratory distress syndrome or sepsis often go hand in hand with severe vascular leakage. During inflammation, endothelial cell integrity and intact barrier function are crucial to limit leukocyte and plasma extravasation. Prostaglandin D2 (PGD2)
Dingzhi Wang et al.
Gastroenterology, 149(7), 1884-1895 (2015-08-12)
Inflammation may contribute to the formation, maintenance, and expansion of cancer stem cells (CSCs), which have the capacity for self-renewal, differentiation, and resistance to cytotoxic agents. We investigated the effects of the inflammatory mediator prostaglandin E2 (PGE2) on colorectal CSC

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico