Skip to Content
Merck
All Photos(1)

Key Documents

EHU077321

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qianfeng Zhuang et al.
Acta biochimica et biophysica Sinica, 50(5), 465-472 (2018-04-13)
Calpain small subunit 1 (Capn4) has been shown to correlate with the metastasis/invasion of clear cell renal cell carcinoma (ccRCC). This study aimed to further elucidate the molecular mechanisms underlying Capn4-mediated ccRCC progression. The mRNA expression levels in ccRCC cells
Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Chang Liu et al.
Cancer medicine, 10(1), 337-349 (2020-12-07)
Lidocaine, one of the most commonly used local anesthetics during surgery, has been reported to suppress cancer cell growth via blocking voltage-gated sodium channels (VGSCs). VGSC 1.5 (NaV 1.5) is highly expressed in invasive cancers including ovarian cancer. This study
Zhaokang Cheng et al.
The Journal of biological chemistry, 292(6), 2065-2079 (2016-12-21)
Autophagy is an evolutionarily conserved intracellular degradation/recycling system that is essential for cellular homeostasis but is dysregulated in a number of diseases, including myocardial hypertrophy. Although it is clear that limiting or accelerating autophagic flux can result in pathological cardiac
Qiqiao Du et al.
Frontiers in oncology, 10, 36-36 (2020-03-03)
Background: Cervical cancer remains a leading cause of death in women due to metastasis to distant tissues and organs. Integrins are involved in cancer metastasis. However, whether integrin α3 participates in cervical cancer metastasis is under investigation. In this study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service