Skip to Content
Merck
All Photos(1)

Documents

EMU001851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nkx3-1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGCATCCATCTTTCTGGTAGCAACAGTTCTGCTGATAACTGCATATATCAGAAACTGTCTTCCCTGGGGGTCTCTGGGAAAAAGCCACAGTGGCTGATGTCAAGGAGTCGGAAGCAAGAAATGTACAGATGCAAACTGTTGGGGGTTCCCAGGGAACACTCCAATTCTTCTCTGGTGGGCAGGTGAAAGATCTGGGGCAGTGACTATTTGAAGATGTAGTCCCAGTTCCAAGTGTCCTGTAGGTGACTGCTGCCCGCTCCCCTGTTTAGAGAGAGCCAGGCAAGTTTGAGTCTTGTTTCCAGAACTTAGAATGGCTACAGATGCAATGGCTATATCGTTCCTAGGAATTCTGTTGTGGCAACTCCATCCTCTCCCATGACTGAGTATCATGGAAGGGCCAA

Ensembl | mouse accession no.

ENSMUSG00000022061

NCBI accession no.

NM_010921

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... NKX3-1(18095) , Nkx3-1(18095)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Xi-Liang Wang et al.
PloS one, 10(8), e0136049-e0136049 (2015-08-28)
MicroRNA (miRNA) is a kind of short non-coding RNA, involved in various cellular processes. During keratinocyte differentiation, miRNAs act as important regulators. In this study, we demonstrated by microarray assay that the expression of miR-378b significantly increased during keratinocytes differentiation.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service