Skip to Content
Merck
All Photos(1)

Key Documents

EHU152551

Sigma-Aldrich

MISSION® esiRNA

targeting human LDLR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCACAACCAGGACGGCTACAGCTACCCCTCGAGACAGATGGTCAGTCTGGAGGATGACGTGGCGTGAACATCTGCCTGGAGTCCCGTCCCTGCCCAGAACCCTTCCTGAGACCTCGCCGGCCTTGTTTTATTCAAAGACAGAGAAGACCAAAGCATTGCCTGCCAGAGCTTTGTTTTATATATTTATTCATCTGGGAGGCAGAACAGGCTTCGGACAGTGCCCATGCAATGGCTTGGGTTGGGATTTTGGTTTCTTCCTTTCCTCGTGAAGGATAAGAGAAACAGGCCCGGGGGGACCAGGATGACACCTCCATTTCTCTCCAGGAAGTTTTGAGTTTCTCTCCACCGTGACACAATCCTCAAACATGGAAGATGAAAGGGGAGGGGATGTCAGGCCCAGAGAAGCAAGTGGCTTTCAACACACAACAGCAGATGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xue-Hai Liang et al.
Nucleic acids research, 45(16), 9528-9546 (2017-09-22)
A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting
E J Gallagher et al.
Oncogene, 36(46), 6462-6471 (2017-08-02)
Obesity is associated with an increase in cancer-specific mortality in women with breast cancer. Elevated cholesterol, particularly low-density lipoprotein cholesterol (LDL-C), is frequently seen in obese women. Here, we aimed to determine the importance of elevated circulating LDL, and LDL
Kentaro Gokita et al.
Molecular therapy. Nucleic acids, 19, 330-338 (2019-12-27)
MicroRNAs (miRNAs) are endogenous small noncoding RNAs that negatively regulate gene expression by interfering with the translation or stability of target transcripts. Some tumor-suppressive miRNAs can concurrently target multiple cancer-promoting genes and may be useful as therapeutic anticancer agents. However
Lei Miao et al.
Nature communications, 11(1), 2424-2424 (2020-05-18)
Lipid-like nanoparticles (LNPs) have potential as non-viral delivery systems for mRNA therapies. However, repeated administrations of LNPs may lead to accumulation of delivery materials and associated toxicity. To address this challenge, we have developed biodegradable lipids which improve LNPs clearance
Wenjia Lai et al.
International journal of nanomedicine, 15, 1481-1498 (2020-03-20)
It is well known that when exposed to human blood plasma, nanoparticles are predominantly coated by a layer of proteins, forming a corona that will mediate the subsequent cell interactions. Magnetosomes are protein-rich membrane nanoparticles which are synthesized by magnetic

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service