Skip to Content
Merck
All Photos(1)

Key Documents

EHU137321

Sigma-Aldrich

MISSION® esiRNA

targeting human TBX21

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$417.00
50 μG
$725.00

$417.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$417.00
50 μG
$725.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$417.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATGTTTGTGGACGTGGTCTTGGTGGACCAGCACCACTGGCGGTACCAGAGCGGCAAGTGGGTGCAGTGTGGAAAGGCCGAGGGCAGCATGCCAGGAAACCGCCTGTACGTCCACCCGGACTCCCCCAACACAGGAGCGCACTGGATGCGCCAGGAAGTTTCATTTGGGAAACTAAAGCTCACAAACAACAAGGGGGCGTCCAACAATGTGACCCAGATGATTGTGCTCCAGTCCCTCCATAAGTACCAGCCCCGGCTGCATATCGTTGAGGTGAACGACGGAGAGCCAGAGGCAGCCTGCAACGCTTCCAACACGCATATCTTTACTTTCCAAGAAACCCAGTTCATTGCCGTGACTGCCTACCAGAATGCCGAGATTACTCAGCTGAAAATTGATAATAACCCCTTTGCCAAAGGATTCCGGGAGAACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huiyong Peng et al.
Journal of immunology research, 2020, 6401978-6401978 (2020-05-08)
Long noncoding RNAs (lncRNAs) have been increasingly recognized as key immune molecules that participate in the pathogenesis of autoimmune diseases. Previous studies have demonstrated that the lncRNA Ifng-AS1, a key scaffold that contributes to the transcription of IFN-γ, depends on
Shigen Hayashi et al.
American journal of respiratory cell and molecular biology, 61(4), 525-536 (2019-04-10)
Chronic obstructive pulmonary disease (COPD) is a progressive lung disease characterized by peripheral airways inflammation and emphysema. Emerging evidence indicates a contribution of both innate and adaptive immune cells to the development of COPD. Transcription factor T-bet modulates the function
Wenjing Yi et al.
Immunology, 150(3), 301-311 (2016-11-04)
Hepatitis C virus (HCV) induces a high rate of chronic infection via dysregulation of host immunity. We have previously shown that T-cell immunoglobulin and mucin domain protein-3 (Tim-3) is up-regulated on monocyte/macrophages (M/Mφ) during chronic HCV infection; little is known
Jason S Weinstein et al.
The Journal of experimental medicine, 215(1), 337-355 (2017-12-08)
Follicular helper T (Tfh) cells promote germinal center (GC) B cell survival and proliferation and guide their differentiation and immunoglobulin isotype switching by delivering contact-dependent and soluble factors, including IL-21, IL-4, IL-9, and IFN-γ. IL-21 and IFN-γ are coexpressed by

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service