Skip to Content
Merck
All Photos(1)

Documents

EHU116371

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGAAGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCTAGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCA

Ensembl | human accession no.

ENSG00000182718

NCBI accession no.

NM_001002858

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ANXA2(302) , ANXA2(302)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weining Wu et al.
Journal of experimental & clinical cancer research : CR, 38(1), 133-133 (2019-03-23)
Glioblastoma multiforme (GBM) is the most common and aggressive form of astrocytoma among adult brain tumors. Multiple studies have shown that long non-coding RNAs (lncRNAs) play important roles in acting as molecular sponge for competing with microRNAs (miRNAs) to regulate
Jie Liu et al.
BMC biochemistry, 4, 10-10 (2003-09-10)
Annexin II heavy chain (also called p36, calpactin I) is lost in prostate cancers and in a majority of prostate intraepithelial neoplasia (PIN). Loss of annexin II heavy chain appears to be specific for prostate cancer since overexpression of annexin
Isah Abubakar Aliyu et al.
Viruses, 11(4) (2019-04-12)
Recent evidence has demonstrated that dengue virus requires active filopodia formation for a successful infection. However, the cellular factor involved in the interaction has not been fully elucidated. We used a combination of virus overlay protein binding assay and LC-MS/MS
Shantae M Thornton et al.
Cells, 9(4) (2020-04-25)
Langerhans cells (LC) are the resident antigen presenting cells of the mucosal epithelium and play an essential role in initiating immune responses. LC are the only cells in the body to contain Birbeck granules (BG), which are unique cytoplasmic organelles
Yuichi Mazaki et al.
Biochemical and biophysical research communications, 511(1), 69-72 (2019-02-18)
The overexpression of endothelin (ET)-1 or ET receptors (ETRs) is related to initiation and progression of tumor. In cancer cells, ET-1 activates various signaling pathways, including mitogen-activated protein kinase, phosphatidylinositol 3-kinase, protein kinase C through ETRs, although the mechanisms by
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service