Skip to Content
Merck
All Photos(1)

Key Documents

EHU113781

Sigma-Aldrich

MISSION® esiRNA

targeting human OLA1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAATTAAACCACCCCCAATCATTGGAAGATTTGGAACCTCACTGAAAATTGGTATTGTTGGATTGCCAAATGTTGGGAAATCTACTTTCTTCAATGTGTTAACCAATAGTCAGGCTTCAGCAGAAAACTTCCCGTTCTGCACTATTGATCCTAATGAGAGCAGAGTACCTGTGCCAGATGAAAGGTTTGACTTTCTTTGTCAATACCACAAACCAGCAAGCAAAATTCCTGCCTTTCTAAATGTGGTGGATATTGCTGGCCTTGTGAAAGGAGCTCACAATGGGCAGGGCCTGGGGAATGCTTTTTTATCTCATATTAGTGCCTGTGATGGCATCTTTCATCTAACACGTGCTTTTGAAGATGATGATATCACGCACGTTGAAGGAAGTGTAGATCCTATTCGAGATATAGAAATAATACATGAAGAGCTTCAGCTTAAAGATGAGGAAATGATTGGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Elia Martínez-Baeza et al.
Mutagenesis, 31(4), 463-473 (2016-03-18)
Environmental pollutants are complex mixtures in which metals are ubiquitous. Metal mixtures of arsenic, cadmium and lead are present in the occupational environment and generate health effects such as cardiovascular, renal and cancer diseases. Cell transformation induced by metal mixtures
Jianzhou Liu et al.
BMC molecular and cell biology, 21(1), 65-65 (2020-09-16)
The human Obg-like ATPase 1 (OLA1) protein has been reported to play an important role in cancer cell proliferation. The molecular mechanism underlying OLA1 regulated oral metastasis is still unknown. We investigated in this study the regulatory role of OLA1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service