Skip to Content
Merck
All Photos(1)

Key Documents

EHU092431

Sigma-Aldrich

MISSION® esiRNA

targeting human USP25

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGCTGTTCCTCATCTGTGCTTATCAGAATAACAAAGAACTCTTGTCTAAAGGCTTATACAGAGGACATGATGAAGAATTGATATCACATTATAGAAGAGAATGTTTGCTAAAATTAAATGAGCAAGCCGCAGAACTCTTCGAATCTGGAGAGGATCGAGAAGTAAACAATGGTTTGATTATCATGAATGAGTTTATTGTCCCATTTTTGCCATTATTACTGGTGGATGAAATGGAAGAAAAGGATATACTAGCTGTAGAAGATATGAGAAATCGATGGTGTTCCTACCTTGGTCAAGAAATGGAACCACACCTCCAAGAAAAGCTGACAGATTTTTTGCCAAAACTGCTTGATTGTTCTATGGAGATTAAAAGTTTCCATGAGCCACCGAAGTTACCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian Wen et al.
Molecular immunology, 106, 53-62 (2018-12-24)
The inhibition of tumor necrosis factor receptor-associated factor 3 (TRAF3) degradation induces endotoxin tolerance (ET) in macrophages. However, the mechanisms leading to TRAF3 inhibition by ET are largely unknown. Here, we found that ubiquitin-specific peptidase 25 (USP25), a deubiquitinating enzyme
Changyu Ding et al.
Canadian journal of physiology and pharmacology, 95(5), 481-491 (2017-01-31)
Lipopolysaccharide (LPS) is a key pathogenic factor in sepsis, and its recognition by toll-like receptor 4 (TLR4) can activate two district signaling pathways, leading to activation of transcription factors including NF-κB and interferon regulatory factor 3 (IRF3). Chloroquine (CQ) has
Chen Long et al.
American journal of physiology. Lung cellular and molecular physiology, 318(2), L252-L263 (2019-11-21)
Cigarette smoking increases susceptibility for microbial infection in respiratory system. However, the underlying molecular mechanism(s) is not fully elucidated. Here we report that cigarette smoking extract (CSE) increases bacterial load in lung epithelial cells via downregulation of the ubiquitin-specific protease

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service