Skip to Content
Merck
All Photos(1)

Documents

EHU089831

Sigma-Aldrich

MISSION® esiRNA

targeting human MIA3 (1)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGAGAACAGAATGTCAAGAATCAGGACTTGTTGCAGCAGGAAATCGAAGACTGGAGTAAATTACATGCTGAGCTCAGTGAGCAAATCAAATCATTTGAGAAGTCTCAGAAAGATTTGGAAGTAGCTCTTACTCACAAGGATGATAATATTAATGCTTTGACTAACTGCATTACACAGTTGAATCTGTTAGAGTGTGAATCTGAATCTGAGGGTCAAAATAAAGGTGGAAATGATTCAGATGAATTAGCAAATGGAGAAGTGGGAGGTGACCGGAATGAGAAGATGAAAAATCAAATTAAGCAGATGATGGATGTCTCTCGGACACAGACTGCAATATCGGTAGTTGAAGAGGATCTAAAGCTTTTACAGCTTAAGCTAAGAGCCTCCGTGTCCACTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jessica L Maiers et al.
Hepatology (Baltimore, Md.), 65(3), 983-998 (2017-01-01)
Fibrogenesis encompasses the deposition of matrix proteins, such as collagen I, by hepatic stellate cells (HSCs) that culminates in cirrhosis. Fibrogenic signals drive transcription of procollagen I, which enters the endoplasmic reticulum (ER), is trafficked through the secretory pathway, and
Yabo Li et al.
Journal of the American Heart Association, 9(7), e014146-e014146 (2020-04-03)
Background Epistasis describes how gene-gene interactions affect phenotypes, and could have a profound impact on human diseases such as coronary artery disease (CAD). The goal of this study was to identify gene-gene interactions in CAD using an easily generalizable multi-stage
Joan Chang et al.
Nature cell biology, 22(1), 74-86 (2020-01-08)
Collagen is the most abundant secreted protein in vertebrates and persists throughout life without renewal. The permanency of collagen networks contrasts with both the continued synthesis of collagen throughout adulthood and the conventional transcriptional/translational homeostatic mechanisms that replace damaged proteins

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service