Skip to Content
Merck
All Photos(1)

Key Documents

EHU081571

Sigma-Aldrich

MISSION® esiRNA

targeting human INHBA

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$417.00
50 μG
$725.00

$417.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$417.00
50 μG
$725.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$417.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCGCACAGACCTTTCCTCATGCTGCAGGCCCGGCAGTCTGAAGACCACCCTCATCGCCGGCGTCGGCGGGGCTTGGAGTGTGATGGCAAGGTCAACATCTGCTGTAAGAAACAGTTCTTTGTCAGTTTCAAGGACATCGGCTGGAATGACTGGATCATTGCTCCCTCTGGCTATCATGCCAACTACTGCGAGGGTGAGTGCCCGAGCCATATAGCAGGCACGTCCGGGTCCTCACTGTCCTTCCACTCAACAGTCATCAACCACTACCGCATGCGGGGCCATAGCCCCTTTGCCAACCTCAAATCGTGCTGTGTGCCCACCAAGCTGAGACCCATGTCCATGTTGTACTATGATGATGGTCAAAACATCATCAAAAAGGACATTCAGAACATGATCGTGGAGGAGTGTGGGTGCTCATAGAGTTGCCCAGCCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Carine Ervolino De Oliveira et al.
International journal of oncology, 57(1), 364-376 (2020-05-08)
Poor prognosis associated with the dysregulated expression of activin A in a number of malignancies has been related to with numerous aspects of tumorigenesis, including angiogenesis. The present study investigated the prognostic significance of activin A immunoexpression in blood vessels
Kota Fujiki et al.
Cell death and differentiation, 26(11), 2371-2385 (2019-02-26)
Various types of cell death, including apoptosis, necrosis, necroptosis, and ferroptosis, are induced in renal tubular epithelial cells following exposure to environmental stresses and toxicants such as osmotic stress, ischemia/reperfusion injury, cisplatin, and cadmium. This is known to cause renal

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service