Skip to Content
Merck
All Photos(1)

Key Documents

EHU079121

Sigma-Aldrich

MISSION® esiRNA

targeting human KANK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCAAGGTGGACAAACAGAACCGTGCTGGCTACAGCCCTATTATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCGAGACTGTCCTTCAGCTCTTCCGGCTTGGCAACATCAATGCCAAAGCCAGCCAGGCAGGACAGACGGCCCTGATGCTGGCCGTCAGCCACGGGCGGGTGGACGTTGTCAAAGCCCTGCTGGCCTGTGAGGCAGATGTCAACGTGCAAGATGATGACGGCTCCACGGCCCTCATGTGCGCCTGTGAGCACGGCCACAAGGAGATCGCGGGGCTGCTGCTGGCCGTGCCCAGCTGTGACATCTCACTCACAGATCGCGATGGGAGCACAGCTCTGATGGTGGCCTTGGACGCAGGGCAGAGTGAGATTGCGTCCATGCTGTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mladen Paradžik et al.
Frontiers in cell and developmental biology, 8, 125-125 (2020-03-21)
Integrins are heterodimeric glycoproteins that bind cells to extracellular matrix. Upon integrin clustering, multimolecular integrin adhesion complexes (IACs) are formed, creating links to the cell cytoskeleton. We have previously observed decreased cell migration and increased sensitivity to microtubule (MT) poisons
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service