Skip to Content
Merck
All Photos(1)

Documents

EHU077121

Sigma-Aldrich

MISSION® esiRNA

targeting human OCLN

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGAAGAGCAGGAAGGTCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAGAAGGCTGATGCCAAGTTGTTTGA

Ensembl | human accession no.

ENSG00000197822

NCBI accession no.

NM_002538

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... OCLN(100506658) , OCLN(4950)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

James Keaney et al.
Science advances, 1(8), e1500472-e1500472 (2015-10-23)
The blood-brain barrier (BBB) is essential for maintaining brain homeostasis and protecting neural tissue from damaging blood-borne agents. The barrier is characterized by endothelial tight junctions that limit passive paracellular diffusion of polar solutes and macromolecules from blood to brain.
Kentaro Jingushi et al.
International journal of oncology, 51(1), 289-297 (2017-05-24)
Renal cell carcinoma (RCC) is the most common neoplasm of the adult kidney, and clear cell RCC (ccRCC) represents its most common histological subtype. Although several studies have reported high expression of miR-122 in ccRCC, its physiological role remains unclear.
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Thomas Volksdorf et al.
The American journal of pathology, 187(6), 1301-1312 (2017-04-17)
Tight junction (TJ) proteins are known to be involved in proliferation and differentiation. These processes are essential for normal skin wound healing. Here, we investigated the TJ proteins claudin-1 and occludin in ex vivo skin wound healing models and tissue samples
Dalia S Elhelw et al.
Archives of virology, 162(11), 3283-3291 (2017-06-24)
Occludin (OCLN) is an essential factor for HCV entry through interacting with other surface receptors. The aim of this study was to investigate the epigenetic regulation of Occludin expression and to study its impact on viral infectivity. microRNAs expression was
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service