Skip to Content
Merck
All Photos(1)

Documents

EHU069131

Sigma-Aldrich

MISSION® esiRNA

targeting human XBP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGCCCCTCAGAGAATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGACCTCGTTCCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATCTTCCTGCCTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAGTGACATGTCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACTCTTTCCCCAGCTGATTAGTGTCTAAGGAATGATCCAATACTGTTGCCCTTTTCCTTGACTATTACACTGCCTGGAGGATAGCAGAGAAGCCTGTCTGTACTTCATTCAAAAAGCCAAAATAGAGAGTATACAGTCCTAGAGAATTCCTCTATTTGTTCAGATCTCATAGATGACCCCCAGGTATTGTCTTTTGACATCCAGCAGTCCAAGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yukako Tokutake et al.
International journal of molecular sciences, 21(1) (2020-01-01)
In skeletal muscle, myoblast differentiation results in the formation of multinucleated myofibers. Although recent studies have shown that unfolded protein responses (UPRs) play an important role in intracellular remodeling and contribute to skeletal muscle differentiation, the involvement of IRE1-XBP1 signaling
A-F Song et al.
European review for medical and pharmacological sciences, 24(22), 11675-11682 (2020-12-05)
Rheumatoid arthritis (RA) is an autoimmune, inflammatory disease mainly manifested by joint damage. Its mechanism is not completely clear at present. Previous studies have found that microRNA-34a-5p (miR-34a-5p) is involved in the development of many inflammatory diseases. In this study
Hui-Ting Hsu et al.
Clinica chimica acta; international journal of clinical chemistry, 479, 66-71 (2018-01-07)
Squamous cell carcinoma is the most common cancer of the oral cavity. In spite of advancements in surgical, chemoradiological and targeted therapies, these therapeutic strategies still have had little impact on survival rates. X-box binding protein-1 (XBP-1) is a potent
Akihiro Kishino et al.
Scientific reports, 7(1), 4442-4442 (2017-07-02)
The purpose of this study was to clarify the relationship among X-box-binding protein 1 unspliced, spliced (XBP1u, s), Forkhead box O1 (FoxO1) and autophagy in the auditory cells under endoplasmic reticulum (ER) stress. In addition, the relationship between ER stress
Joshua M Royal et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 13527-13545 (2019-09-29)
Cholera toxin B subunit (CTB) exhibits broad-spectrum biologic activity upon mucosal administration. Here, we found that a recombinant CTB containing an endoplasmic reticulum (ER) retention motif (CTB-KDEL) induces colon epithelial wound healing in colitis via the activation of an unfolded

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service