Skip to Content
Merck
All Photos(1)

Documents

EHU067331

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM28

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAAGGACCACCAGTACCAGTTCTTAGAGGATGCAGTGAGGAACCAGCGCAAGCTCCTGGCCTCACTGGTGAAGCGCCTTGGGGACAAACATGCAACATTGCAGAAGAGCACCAAGGAGGTTCGCAGCTCAATCCGCCAGGTGTCTGACGTACAGAAGCGTGTGCAAGTGGATGTCAAGATGGCCATCCTGCAGATCATGAAGGAGCTGAATAAGCGGGGCCGTGTGCTGGTCAATGATGCCCAGAAGGTGACTGAGGGGCAGCAGGAGCGCCTGGAGCGGCAGCACTGGACCATGACCAAGATCCAGAAGCACCAGGAGCACATTCTGCGCTTTGCCTCTTGGGCTCTGGAGAGTGACAACAACACAGCCCTTTTGCTTTCTAAGAAGTTGATCTACTTCCAGCTGCACCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongtao Liu et al.
Chemico-biological interactions, 311, 108772-108772 (2019-07-28)
Atherosclerosis is a common type of cardiovascular disease (CVD), remaining one of the leading causes of global death. Tripartite motif-containing 28 (TRIM28) is a member of TRIM family that has been found to be involved in atherosclerosis. However, the role
Min Li et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(38), 23588-23596 (2020-09-10)
In human cells, the DNA replication factor proliferating cell nuclear antigen (PCNA) can be conjugated to either the small ubiquitinlike modifier SUMO1 or SUMO2, but only SUMO2-conjugated PCNA is induced by transcription to facilitate resolution of transcription-replication conflict (TRC). To
Hitoshi Ohtani et al.
Genome research, 28(8), 1147-1157 (2018-07-05)
We provide a comprehensive genomic and epigenomic map of the more than 500,000 endogenous retroviruses (ERVs) and fragments that populate the intergenic regions of the human genome. The repressive epigenetic marks associated with the ERVs, particularly long terminal repeats (LTRs)
Xiao-Hua Zhang et al.
Molecular medicine reports, 23(3) (2021-01-06)
Myocardial ischemia/reperfusion (MIR) injury, which occurs following acute myocardial infarction, can cause secondary damage to the heart. Tripartite interaction motif (TRIM) proteins, a class of E3 ubiquitin ligases, have been recognized as critical regulators in MIR injury. Zenglv Fumai Granule (ZFG) is a
A Bakr et al.
Nucleic acids research, 43(6), 3154-3166 (2015-03-11)
Ataxia-telangiectasia mutated (ATM) is needed for the initiation of the double-strand break (DSB) repair by homologous recombination (HR). ATM triggers DSB end resection by stimulating the nucleolytic activity of CtIP and MRE11 to generate 3'-ssDNA overhangs, followed by RPA loading

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service