Skip to Content
Merck
All Photos(1)

Documents

EHU044261

Sigma-Aldrich

MISSION® esiRNA

targeting human CNR1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGGTTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCTTGCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGTATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGGAGTAAGGACCTGCGACACGCTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCATGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAGCCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGGTCAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Le Yang et al.
Molecular therapy. Nucleic acids, 20, 725-738 (2020-05-15)
Nod-like receptor (NLR) family pyrin domain containing 3 (NLRP3) has been regarded as an important initiator or promoter in multiple inflammatory diseases. However, the relationship between cannabinoid receptor 1 (CB1) and macrophage NLRP3 inflammasome and the corresponding molecular mechanism in
Chih-Yuan Lin et al.
Journal of molecular and cellular cardiology, 85, 249-261 (2015-06-21)
Cannabinoid receptor type 1 (CB1R) plays an important role in the development of myocardial hypertrophy and fibrosis-2 pathological features of uremic cardiomyopathy. However, it remains unknown whether CB1R is involved in the pathogenesis of uremic cardiomyopathy. Here, we aimed to
Elena Ciaglia et al.
Oncotarget, 6(17), 15464-15481 (2015-05-27)
Herein we show that a majority of human brain tumor samples and cell lines over-expressed cannabinoid receptor CB1 as compared to normal human astrocytes (NHA), while uniformly expressed low levels of CB2. This finding prompted us to investigate the therapeutic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service