Skip to Content
Merck
All Photos(1)

Key Documents

EHU020691

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$417.00
50 μG
$725.00

$417.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)


Select a Size

Change View
20 μG
$417.00
50 μG
$725.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$417.00


Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCACTTTCCAATCACATCCAAATTCCAGCATGCCTGGTTCAAGAGAAGTTCAGATACACCCGGACTCGGATCAAATCTCAGGGCTTCATGGGAATTCATTTCACTCTGAAGATGAAATTGAATATGAAAACCAAAAAAGGCTGGAAGAAGAGGAGGACTTGAATGTGCTTACATTTGAAGATCTTCTTTGCTTTGCATATCAAGTTGCCAAAGGAATGGAATTTCTGGAATTTAAGTCGTGTGTTCACAGAGACCTGGCCGCCAGGAACGTGCTTGTCACCCACGGGAAAGTGGTGAAGATATGTGACTTTGGATTGGCTCGAGATATCATGAGTGATTCCAACTATGTTGTCAGGGGCAATGCCCGTCTGCCTGTAAAATGGATGGCCCCCGAAAGCCTGTTTGAAGGCATCTACACCATTAAGAGTGATGTCTGGTCATATGGAATATTACTGTGGGAAATCTTCTCACTTGGTGTGAATCCTTACCCTGGCATTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rui-Fang Dong et al.
Gene, 697, 152-158 (2019-02-18)
Neuron damage contributes to ischemic brain injury. Although FMS-like tyrosine kinase-3 (FLT3) plays a critical role in neuron survival, its function and molecular mechanism in cerebral ischemia/reperfusion injury is unclear. In the present study, we exposed SH-SY5Y cells to oxygen
Anna Skwarska et al.
Biochemical pharmacology, 95(4), 238-252 (2015-04-22)
Drugs targeting receptor tyrosine kinase FLT3 are of particular interest since activating FLT3-internal tandem duplication (ITD) mutations abundantly occur in fatal acute myeloid leukemias (AMLs). Imidazoacridinone C-1311, a DNA-reactive inhibitor of topoisomerase II, has been previously shown to be a

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service