Skip to Content
Merck
All Photos(1)

Key Documents

EHU054411

Sigma-Aldrich

MISSION® esiRNA

targeting human USF1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGCACTGGTCAATTCTTTGTGATGATGTCACCACAAGAAGTACTGCAGGGAGGAAGCCAGCGCTCAATTGCCCCTAGGACTCACCCTTATTCCCCGAAGTCAGAAGCTCCCCGGACGACTCGGGATGAGAAACGCAGGGCTCAGCATAATGAAGTGGAGCGTCGCCGCCGAGACAAGATCAACAACTGGATCGTGCAGCTCTCCAAGATAATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAAAGGTGGGATTCTATCCAAAGCTTGTGATTATATCCAGGAGCTTCGGCAGAGTAACCACCGCTTGTCTGAAGAACTGCAGGGACTTGACCAACTGCAGCTGGACAATGACGTGCTTCGACAACAGGTGGAAGATCTTAAAAACAAGAATCTGCTGCTTCGAGCTCAGTTGCGGCACCACGGATTAGAGGTCGT

Ensembl | human accession no.

ENSG00000158773

NCBI accession no.

NM_007122

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... USF1(7391) , USF1(7391)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiangxiang Liu et al.
Molecular therapy. Nucleic acids, 22, 750-765 (2020-11-25)
Hepatocellular carcinoma (HCC), one of the most aggressive malignancies, ranks as the fourth leading cause of cancer-related deaths worldwide. Emerging evidence indicates that RNA N6-methyladenosine (m6A) plays a critical role in tumor progression. However, the biological function of YTHDF1 in
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Jun Guo et al.
FEBS letters, 592(16), 2725-2738 (2018-07-29)
Previous studies indicate that the transcription factor upstream stimulating factor 1 (USF1) is involved in the regulation of lipid and glucose metabolism. However, the role of USF1 in lipid-induced autophagy remains unknown. Interestingly, we found that USF1 overexpression suppresses autophagy-related
Weiwei Jiang et al.
Protein & cell, 11(11), 825-845 (2020-03-08)
This study was designed to evaluate ERK5 expression in lung cancer and malignant melanoma progression and to ascertain the involvement of ERK5 signaling in lung cancer and melanoma. We show that ERK5 expression is abundant in human lung cancer samples
Chunyu Cao et al.
International journal of cancer, 143(6), 1388-1401 (2018-04-11)
Our recent studies have shown that cross-talk between histone deacetylase 5 (HDAC5) and lysine-specific demethylase 1 (LSD1) facilitates breast cancer progression. In this work, we demonstrated that regulatory activity at -356 to -100 bp promoter element plays a critical role
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service