Skip to Content
Merck
All Photos(1)

Key Documents

EHU022821

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lei Li et al.
Biochimica et biophysica acta. General subjects, 1862(8), 1790-1800 (2018-05-08)
HIV infection and/or the direct pathogenic effects of circulating HIV proteins impairs the physiological function of mesenchymal stem cells (MSCs), and contribute to the pathogenesis of age-related clinical comorbidities in people living with HIV. The SDF-1/CXCR4 pathway is vital for
Chunming Jiang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(6), 2250-2260 (2018-05-08)
Osteosarcoma, the most common primary bone malignancy, arises from primitive transformed cells of mesenchymal origin with the worldwide increasing morbidity and mortality. Previous studies found apoptosis of osteosarcoma cells was essential for an effective manner to improve the progress of
Younghun Jung et al.
Cancer research, 78(8), 2026-2039 (2018-02-13)
There is evidence that cancer stem-like cells (CSC) and neuroendocrine behavior play critical roles in the pathogenesis and clinical course of metastatic castration-resistant prostate cancer (m-CRPC). However, there is limited mechanistic understanding of how CSC and neuroendocrine phenotypes impact the
Markus Eberl et al.
EMBO molecular medicine, 4(3), 218-233 (2012-02-02)
Inhibition of Hedgehog (HH)/GLI signalling in cancer is a promising therapeutic approach. Interactions between HH/GLI and other oncogenic pathways affect the strength and tumourigenicity of HH/GLI. Cooperation of HH/GLI with epidermal growth factor receptor (EGFR) signalling promotes transformation and cancer
Ying Wang et al.
Frontiers in oncology, 9, 1487-1487 (2020-02-13)
Purpose: Due to a lack of recognized molecular targets for therapy, patients with triple-negative breast cancer (TNBC), unlike other subtypes of breast cancers, generally have not benefited from the advances made with targeted agents. The CXCR4/SDF-1 axis is involved in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service