Skip to Content
Merck
All Photos(1)

Documents

EHU032931

Sigma-Aldrich

MISSION® esiRNA

targeting human P4HB

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCGTGAACTGGCTGAAGAAGCGCACGGGCCCGGCTGCCACCACCCTGCCTGACGGCGCAGCTGCAGAGTCCTTGGTGGAGTCCAGCGAGGTGGCTGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTCTGCCAAGCAGTTTTTGCAGGCAGCAGAGGCCATCGATGACATACCATTTGGGATCACTTCCAACAGTGACGTGTTCTCCAAATACCAGCTCGACAAAGATGGGGTTGTCCTCTTTAAGAAGTTTGATGAAGGCCGGAACAACTTTGAAGGGGAGGTCACCAAGGAGAACCTGCTGGACTTTATCAAACACAACCAGCTGCCCCTTGTCATCGAGTTCACCGAGCAGACAGCCCCGAAGATTTTTGGAGGTGAAATCAAGACTCACATCCTGCTGTTCTTGC

Ensembl | human accession no.

ENSG00000185624

NCBI accession no.

NM_000918

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... P4HB(5034) , P4HB(5034)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Xia et al.
Oncotarget, 8(5), 8512-8521 (2017-01-05)
P4HB and GRP78 are molecular chaperones involved in cellular response to ER stress. They have been linked to cancer progression; however, their roles in hepatocellular carcinoma (HCC) are largely unclear. In this study, we found that P4HB is overexpressed in
Rashed Alhammad et al.
Oncology reports, 44(6), 2406-2418 (2020-10-31)
Oxidoreductase protein disulphide isomerases (PDI) are involved in the regulation of a variety of biological processes including the modulation of endoplasmic reticulum (ER) stress, unfolded protein response (UPR), ER‑mitochondria communication and the balance between pro‑survival and pro‑death pathways. In the
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Yajing Liu et al.
Cancer research, 79(11), 2923-2932 (2019-04-19)
Patients with glioblastoma multiforme (GBM) survive on average 12 to 14 months after diagnosis despite surgical resection followed by radiotheraphy and temozolomide therapy. Intrinsic or acquired resistance to chemo- and radiotherapy is common and contributes to a high rate of
Xing Ma et al.
Oncology letters, 20(1), 257-265 (2020-06-23)
The aim of the present study was to investigate the role of prolyl 4-hydroxylase beta polypeptide (P4HB) in the chemoresistance of liver cancer. Drug-resistant liver cancer cell lines, such as HepG2/adriamycin (ADR) cells, were treated and screened using adriamycin. Gene

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service