Skip to Content
Merck
All Photos(1)

Documents

EHU018301

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARGC1A (2)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTTCAAACATATTTGAGAAGATAGATGAAGAGAATGAGGCAAACTTGCTAGCAGTCCTCACAGAGACACTAGACAGTCTCCCTGTGGATGAAGACGGATTGCCCTCATTTGATGCGCTGACAGATGGAGACGTGACCACTGACAATGAGGCTAGTCCTTCCTCCATGCCTGACGGCACCCCTCCACCCCAGGAGGCAGAAGAGCCGTCTCTACTTAAGAAGCTCTTACTGGCACCAGCCAACACTCAGCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

PPARGC1A (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional regulator which plays a key role in insulin signaling and mitochondrial regulation. It controls metabolism in many organs. For instance, it regulates gluconeogenesis in hepatocytes, thermogenesis in brown adipose tissue, and mitochondrial biogenesis and fatty acid oxidation in the heart. PPARGC1A also attenuates oxidative damage. Mutations in this gene are associated with type 2 diabetes mellitus. It is downregulated in prostate cancer. Presence of PPARGC1A inhibits prostate cancer progression and metastasis. However, presence of this protein gives selective advantages in breast cancer and melanoma cells.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiao-Xia Zhang et al.
Cell biochemistry and function, 38(5), 549-557 (2020-02-11)
Neuregulin-1 (NRG-1)/erythroblastic leukaemia viral oncogene homologues (ErbB) pathway activation plays a crucial role in regulating the adaptation of the adult heart to physiological and pathological stress. In the present study, we investigate the effect of recombined human NRG-1 (rhNRG-1) on
PGC-1a, glucose metabolism and type 2 diabetes mellitus.
Wu H
The Journal of Endocrinology, 229, R99-R99 (2016)
Lack of direct evidence for natural selection at the candidate thrifty gene locus, PPARGC1A.
Cadzow M
BMC Medical Genetics, 17, 80-80 (2016)
The metabolic co-regulator PGC1a suppresses prostate cancer metastasis.
Torrano V, et. al.
Nature Cell Biology, 18, 645-645 (2016)
Jung Hyun Park et al.
FEBS open bio, 11(1), 61-74 (2020-08-30)
Several studies have indicated that cholestatic liver damage involves mitochondria dysfunction. However, the precise mechanism by which hydrophobic bile salts cause mitochondrial dysfunction is not clear. In this study, we intended to determine the pathogenesis of cholestatic liver injury associated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service