Skip to Content
Merck
All Photos(1)

Key Documents

EMU095351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stmn1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCCACAAAATGGAGGCTAACAAAGAGAACCGGGAGGCGCAGATGGCGGCCAAGCTGGAGCGCTTGCGAGAGAAGGACAAGCACGTGGAAGAGGTGCGGAAGAACAAAGAATCCAAAGACCCCGCGGATGAGACTGAGGCTGACTAAGTTGTCCCGAGAACTGACTTTCTCCCCGACCCCGTCCTAAATATCCAAAGACTGTACTGGCCAGTGTCCTTTACTTTCCCTCCTGACAGATAGTCTAGAAGCCGATGTAGGACCGTATAGGTAGATCCAGACCGTGAGATGTTTTAGGGGCTCAAGGGGAGAAACTGAAAGTGTTTTACTCTTTTTTAAAGTGTTGGTCTTTCTAATGTAGCTATTTTTCTCGTTGCATCTTTTCCACTCGGGCACAATCGGTGTGCTGGGTTAATGGCTAGTACTGTATTGACTGTGGAAGACGTTTGTGAAGAGTATGTAGTGGCTTCTTCCAACCCATTAGATGCTGAATATCTGTCCACTTTGCGATCCCAATTCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Isioma I Enwerem et al.
PloS one, 10(4), e0122348-e0122348 (2015-04-16)
Small nuclear ribonucleoproteins (snRNPs), which are required for pre-mRNA splicing, contain extensively modified snRNA. Small Cajal body-specific ribonucleoproteins (scaRNPs) mediate these modifications. It is unknown how the box C/D class of scaRNPs localizes to Cajal Bodies (CBs). The processing of
W Feng et al.
Cancer gene therapy, 22(3), 115-121 (2015-01-13)
Paclitaxel (PTX) is broadly considered the drug of choice for treating human esophageal squamous cell cancer (ESCC). However, PTX resistance often ultimately leads to treatment failure. stathmin, or Op18, is a ubiquitously expressed 19-kDa cytosolic phosphoprotein that can integrate various
Kimberly A Birnie et al.
Molecular cancer research : MCR, 13(7), 1106-1118 (2015-04-01)
Malignant pleural mesothelioma (MPM) is often fatal, and studies have revealed that aberrant miRNAs contribute to MPM development and aggressiveness. Here, a screen of miRNAs identified reduced levels of miR-223 in MPM patient specimens. Interestingly, miR-223 targets Stathmin (STMN1), a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service