Skip to Content
Merck
All Photos(1)

Key Documents

EMU092291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Kat2b

Sign Into View Organizational & Contract Pricing

Select a Size


Select a Size

Change View

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCACGTTTCTCACTTGGAGAATGTGTCAGAGGAAGAGATGGACAGACTCCTGGGAATTGTGTTGGATGTGGAGTACCTCTTCACCTGCGTCCACAAAGAAGAAGATGCAGATACCAAACAAGTGTACTTCTACCTATTCAAGCTCTTGAGAAAGTCAATTTTACAAAGAGGAAAACCTGTGGTTGAAGGCTCCTTGGAGAAGAAGCCGCCATTTGAGAAGCCCAGTATTGAACAGGGTGTGAACAACTTCGTGCAGTACAAGTTTAGTCACTTGCCATCGAAAGAGAGGCAGACAACGATCGAGCTGGCCAAGATGTTTCTGAACCGCATCAACTACTGGCATCTGGAGGCTCCATCTCAGCGGAGACTACGGTCTCCCAATGATGACATCTCTGGATACAAGGAAAACTACACAAGGTGGTTGTGCTACTGCAATGTACCGCAGTTCTGTGACAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Need A Sample COA?

This is a sample Certificate of Analysis (COA) and may not represent a recently manufactured lot of this specific product.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

X Gai et al.
Cell death & disease, 6, e1712-e1712 (2015-04-10)
P300/CBP-associated factor (PCAF), a histone acetyltransferase (HAT), has been found to regulate numerous cell signaling pathways controlling cell fate by acetylating both histone and non-histone proteins. We previously reported that PCAF upregulates cell apoptosis by inactivating Serine/Threonine Protein Kinase 1
S-M Jang et al.
Cell death & disease, 6, e1857-e1857 (2015-08-21)
Transcription factor SOX4 has been implicated in skeletal myoblast differentiation through the regulation of Cald1 gene expression; however, the detailed molecular mechanism underlying this process is largely unknown. Here, we demonstrate that SOX4 acetylation at lysine 95 by KAT5 (also

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service