Skip to Content
Merck
All Photos(1)

Key Documents

EHU222251

Sigma-Aldrich

MISSION® esiRNA

targeting human IGHG4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
NOK 1,680.00
50 μG
NOK 2,970.00

NOK 1,680.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
NOK 1,680.00
50 μG
NOK 2,970.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

NOK 1,680.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACGAAGACCTACACCTGCAACGTAGATCACAAGCCCAGCAACACCAAGGTGGACAAGAGAGTTGAGTCCAAATATGGTCCCCCATGCCCATCATGCCCAGCACCTGAGTTCCTGGGGGGACCATCAGTCTTCCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTGAGGTCACGTGCGTGGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAGTTCAACTGGTACGTGGATGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTTCAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGGCCTCCCGTCCTCCATCGAGAAAACCATCTCCAAAGCCAAAGGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGHG4(3503)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S Wongkamchai et al.
Journal of helminthology, 89(5), 552-558 (2014-06-12)
The aim of this study was to develop a low-cost antifilarial immunoglobulin (Ig) G4 detection kit for the diagnosis of lymphatic filariasis. The kit was designed to be used by minimally trained personnel without the constraints of expensive laboratory equipment.
Tatsuya Abé et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 44(10), 850-856 (2014-11-18)
Oral pemphigus vulgaris (PV), an autoimmune blistering disease, is mainly mediated by autoantibodies against desmoglein (Dsg) 3. However, no attention has been paid to IgG subclasses of the autoantibodies against Dsg3 in the diagnostic procedure for PV. Thus, our aim

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service